Metadata-Version: 2.4
Name: sadie-antibody
Version: 2.1.1
Summary: "The Complete Antibody Library"
License: MIT
License-File: LICENSE
Keywords: antibody,bioinformatics,biology,computational biology,protein,immunoinformatics
Author: Jordan R. Willis
Author-email: jwillis0720@gmail.com
Requires-Python: >=3.10
Classifier: Development Status :: 5 - Production/Stable
Classifier: Environment :: Console
Classifier: Intended Audience :: Science/Research
Classifier: License :: OSI Approved :: MIT License
Classifier: Operating System :: MacOS
Classifier: Operating System :: POSIX :: Linux
Classifier: Programming Language :: Python
Classifier: Programming Language :: Python :: 3
Classifier: Programming Language :: Python :: 3.10
Classifier: Programming Language :: Python :: 3.11
Classifier: Programming Language :: Python :: 3.12
Classifier: Programming Language :: Python :: 3.13
Classifier: Programming Language :: Python :: 3.14
Classifier: Programming Language :: Python :: 3 :: Only
Classifier: Programming Language :: Python :: Implementation :: CPython
Classifier: Programming Language :: Python :: Implementation :: PyPy
Classifier: Topic :: Scientific/Engineering :: Bio-Informatics
Requires-Dist: PyYAML (>=6.0,<7.0)
Requires-Dist: biopython (>=1.80)
Requires-Dist: click (>=8.0,<8.2)
Requires-Dist: filetype (>=1.2.0,<2.0.0)
Requires-Dist: ipython (>=8.18.0,<9.0.0)
Requires-Dist: numpy (>=2.3.2) ; python_version >= "3.11"
Requires-Dist: numpy ; python_version < "3.11"
Requires-Dist: openpyxl (>=3.1.0,<4.0.0)
Requires-Dist: pandas (>=2.0,<3.0) ; python_version < "3.11"
Requires-Dist: pandas (>=2.0,<4.0) ; python_version >= "3.11"
Requires-Dist: pyarrow
Requires-Dist: pydantic (>=2.0.0,<3.0.0)
Requires-Dist: pyhmmer (>=0.11.1,<0.12.0)
Requires-Dist: python-Levenshtein (>=0.27.0,<0.28.0)
Requires-Dist: requests (>=2.32.0,<3.0.0)
Requires-Dist: rich (>=14.1.0,<15.0.0)
Requires-Dist: scikit-learn (>=1.5.0,<2.0.0)
Requires-Dist: scipy (>=1.11.0,<2.0.0) ; python_version < "3.11"
Requires-Dist: scipy (>=1.16.1) ; python_version >= "3.11"
Requires-Dist: semantic-version (>=2.10.0,<3.0.0)
Requires-Dist: yarl (>=1.9.0,<2.0.0)
Project-URL: Homepage, https://sadie.jordanrwillis.com
Project-URL: Repository, https://github.com/jwillis0720/sadie
Project-URL: issues, https://github.com/jwillis0720/sadie/issues
Description-Content-Type: text/markdown

<!-- markdownlint-disable -->

<h2 align="center" style="font-family:verdana;font-size:150%"> <b>S</b>equencing <b>A</b>nalysis and <b>D</b>ata Library for <b>I</b>mmunoinformatics <b>E</b>xploration</h2>
<div align="center">
  <img src="https://sadiestaticcrm.s3.us-west-2.amazonaws.com/Sadie.svg" alt="SADIE" style="margin:0.51em;width:50%">
</div>

<div class="flex-container" align="center">
    <div class="flex-container" align="center">
        <a href="https://img.shields.io/badge/Python-3.9%7C3.10%7C3.11%7C3.12%7C3.13-blue">
        <img src="https://img.shields.io/badge/Python-3.9%7C3.10%7C3.11%7C3.12%7C3.13-blue"
            alt="Python Version">
        <a href="https://github.com/psf/black">
        <img src="https://img.shields.io/badge/code%20style-black-000000.svg"
            alt="Format Version">
        <a href="https://codecov.io/gh/jwillis0720/sadie">
        <img src="https://codecov.io/github/jwillis0720/sadie/graph/badge.svg?token=EH9QEX4ZMP"/>
        <a href="https://github.com/pre-commit/pre-commit">
    </div>
    <div class="flex-container" align="center">
        <img src="https://img.shields.io/badge/pre--commit-enabled-brightgreen?logo=pre-commit&logoColor=white"
            alt="pre commit">
        <a href="https://pypi.org/project/sadie-antibody">
        <img src="https://img.shields.io/pypi/v/sadie-antibody?color=blue"
            alt='pypi'>
        <a href="https://sadie.jordanrwillis.com" >
        <img src="https://api.netlify.com/api/v1/badges/59ff956c-82d9-4900-83c7-758ed21ccb34/deploy-status"
            alt="Documentation">
        </a>
        <a href="https://github.com/jwillis0720/sadie/actions/workflows/docs.yml" >
        <img src="https://github.com/jwillis0720/sadie/actions/workflows/docs.yml/badge.svg"
            alt="Documentation">
        </a>
    </div>
    <div class="flex-container" align="center">
        <a href="https://github.com/jwillis0720/sadie/actions/workflows/pyright.yml/badge.svg">
        <img src="https://github.com/jwillis0720/sadie/actions/workflows/pyright.yml/badge.svg"
            alt="Static Type">
    </div>
</div>
<!-- markdownlint-restore -->

## About

---

<!-- use a href so you can use _blank to open new tab -->

**Documentation**: <a href="https://sadie.jordanrwillis.com" target="_blank">https://sadie.jordanrwillis.com</a>

**Source Code**: <a href="https://github.com/jwillis0720/sadie" target="_blank">https://github.com/jwillis0720/sadie</a>

**Colab**: [https://colab.research.google.com/github/jwillis0720/sadie](https://colab.research.google.com/github/jwillis0720/sadie/blob/main/notebooks/airr_c/SADIE_DEMO.ipynb)

---

SADIE is the **S**equencing **A**nalysis and **D**ata library for **I**mmunoinformatics **E**xploration. The key feautures include:

- Provide pre-built **command line applications** for popular immunoinformatics applications.

- Provide a **low-level API framework** for immunoinformatics developers to build higher level tools.

- Provide a **testable** and **reusable** library that WORKS!

- Provide a **bundled**, **customizable**, and **verified** germline reference library.

- Maintain data formats consistent with standards governed by the [**AIRR community**](https://docs.airr-community.org/en/stable/#table-of-contents)

- **Portability** ready to use out the box.

SADIE ships germline gene data in the package. The retired live G3 API is no longer required for reference, AIRR, or renumbering workflows.

SADIE is billed as a "**complete antibody library**", not because it aims to do everything, but because it aims to meet the needs of all immunoinformatics users. SADIE contains both low, mid and high level functionality for immunoinformatics tools and workflows. You can use SADIE as a framework to develop your own tools, use many of the prebuilt contributed tools, or run it in a notebook to enable data exploration. In addition, SADIE aims to port all code to python because relies heavily on the [Pandas](https://www.pandas.org) library, the workhorse of the data science/machine learning age.

## Installation

---

Installation is handled using the python package installer `pip`

```console
$ pip install sadie-antibody
```

No G3 API setup is required for the bundled germline references after installation.

### Development installation.

Pull requests are highly encouraged [here](https://github.com/jwillis0720/sadie/pulls). The development installation uses [pre-commit](https://pre-commit.com/), [flake8](https://flake8.pycqa.org/en/latest/) linting and [black](https://github.com/psf/black) style formatting to maintain code readability and reausability.

```console
$ git clone git@github.com/jwillis0720/sadie.git
$ cd sadie
$ pip install -e .
```

### Offline test run

Run the frozen suite with HTTP proxies pointed at a dead local port:

```console
$ https_proxy=http://127.0.0.1:9 http_proxy=http://127.0.0.1:9 all_proxy=http://127.0.0.1:9 \
  HTTPS_PROXY=http://127.0.0.1:9 HTTP_PROXY=http://127.0.0.1:9 ALL_PROXY=http://127.0.0.1:9 \
  pytest tests -o addopts= -p no:cacheprovider
```

## Quick Usage

Consult the [documentation](https://sadie.jordanrwillis.com) for complete usage. Or checkout our [Colab](https://colab.research.google.com/github/jwillis0720/sadie/blob/main/notebooks/airr_c/SADIE_DEMO.ipynb) notebook

The packaged germline references are used by default; no live G3 lookup is made.

### Command Line Usage

Annotate antibody sequences only from functional human imgt antibodies to a gzip output

```console
$ sadie airr my_sequence.fasta
```

### API

```python
from sadie.airr import Airr
# define a single sequence
pg9_seq = """
    CAGCGATTAGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGTCGTCCCTGAGACTCTCCTGTGCAGCGT
    CCGGATTCGACTTCAGTAGACAAGGCATGCACTGGGTCCGCCAGGCTCCAGGCCAGGGGCTGGAGTGGGT
    GGCATTTATTAAATATGATGGAAGTGAGAAATATCATGCTGACTCCGTATGGGGCCGACTCAGCATCTCC
    AGAGACAATTCCAAGGATACGCTTTATCTCCAAATGAATAGCCTGAGAGTCGAGGACACGGCTACATATT
    TTTGTGTGAGAGAGGCTGGTGGGCCCGACTACCGTAATGGGTACAACTATTACGATTTCTATGATGGTTA
    TTATAACTACCACTATATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCGAGC""".replace(
    "\n", ""
)

# initialize the api
air_api = Airr("human")

# run single sequence string
airr_table = air_api.run_single("PG9", pg9_seq)
```

## License

[![License](https://img.shields.io/github/license/jwillis0720/sadie)](https://opensource.org/licenses/MIT)

- Copyright © Jordan R. Willis, Troy M. Sincomb & Caleb K. Kibet

