Linearize pYPKpw with EcoRV resulting in the linearized vector.
Carry out a PCR with primers 577, 567 and template pYPKa_Z_TDH3tp resulting in
the PCR product 929bp_PCR_prod
5GTTCTGATCCTCGAGCATCTTAAGAATTC...CTCACTAGTGACCTGCAGCCGAC3 ||||||||||||||||||||||| tm 59.0 (dbd) 70.7 3gagtgatcactggacgtcggcTG5 5gttctgatcctcgagcatcttaagaattc3 ||||||||||||||||||||||||||||| tm 56.1 (dbd) 69.4 3CAAGACTAGGAGCTCGTAGAATTCTTAAG...GAGTGATCACTGGACGTCGGCTG5 Taq (rate 30 nt/s) 35 cycles |929bp 95.0°C |95.0°C | |SantaLucia 1998 |_________|_____ 72.0°C |72.0°C|SaltC 50mM | 03min00s|30s \ ________|______| | | \ 56.0°C/ 0min27s| 5min | | | \_____/ | | | | 30s | |4-12°C
Carry out a PCR with primers 468, 467 and template pYPKa_A_SsXYL2 resulting in
the PCR product 1181bp_PCR_prod
5GTCGAGGAACGCCAGGTTGCCCACT...TCTGTGCAGACAAACGCATCAGGAT3 ||||||||||||||||||||||||| tm 59.0 (dbd) 73.8 3agacacgtctgtttgcgtagtcctaAATTTA5 5gtcgaggaacgccaggttgcccact3 ||||||||||||||||||||||||| tm 64.8 (dbd) 79.7 3CAGCTCCTTGCGGTCCAACGGGTGA...AGACACGTCTGTTTGCGTAGTCCTA5 Taq (rate 30 nt/s) 35 cycles |1181bp 95.0°C |95.0°C | |SantaLucia 1998 |_________|_____ 72.0°C |72.0°C|SaltC 50mM | 03min00s|30s \ ________|______| | | \ 59.0°C/ 0min35s| 5min | | | \_____/ | | | | 30s | |4-12°C
Carry out a PCR with primers 568, 578 and template pYPKa_E_PGItp resulting in
the PCR product 1339bp_PCR_prod
5GTGCCATCTGTGCAGACAAACG...ACTTATGAATGTGGCAATGAGACAAGAAC3 ||||||||||||||||||||||||||||| tm 56.5 (dbd) 69.5 3tgaatacttacaccgttactctgttcttg5 5GTGCcatctgtgcagacaaacg3 |||||||||||||||||||||| tm 57.1 (dbd) 71.5 3CACGGTAGACACGTCTGTTTGC...TGAATACTTACACCGTTACTCTGTTCTTG5 Taq (rate 30 nt/s) 35 cycles |1339bp 95.0°C |95.0°C | |SantaLucia 1998 |_________|_____ 72.0°C |72.0°C|SaltC 50mM | 03min00s|30s \ ________|______| | | \ 56.0°C/ 0min40s| 5min | | | \_____/ | | | | 30s | |4-12°C
Mix the four linear DNA fragments and transform a Saccharomyces cerevisiae ura3 mutant with the mixture. The fragments will be assembled by in-vivo homologous recombination:
-|pYPKpw|124 | \/ | /\ | 124|929bp_PCR_prod|50 | \/ | /\ | 50|1181bp_PCR_prod|37 | \/ | /\ | 37|1339bp_PCR_prod|242 | \/ | /\ | 242- | | ---------------------------------------------------------------------
PCR using primers 577 & 467
PCR products (bp)
Correct : 2060
Missing first tp : 1349
Missing gene : 966
Missing both : 255
PCR using primers 468 & 578
PCR products (bp)
Correct : 2483
Missing gene : 1389
Missing last tp : 1470
Missing both : 376