Metadata-Version: 2.2
Name: vdjtools
Version: 3.15.0
Summary: TCR/BCR repertoire analysis — Pgen/generation/inference, diversity, overlap, biomarkers (Python + C++)
Keywords: immunology,tcr,bcr,airr,repertoire,pgen,olga,igor,bioinformatics
Author-Email: Mikhail Shugay <mikhail.shugay@gmail.com>
License: GPL-3.0-or-later
Classifier: Development Status :: 2 - Pre-Alpha
Classifier: Intended Audience :: Science/Research
Classifier: License :: OSI Approved :: GNU General Public License v3 or later (GPLv3+)
Classifier: Programming Language :: Python :: 3
Classifier: Programming Language :: C++
Classifier: Topic :: Scientific/Engineering :: Bio-Informatics
Project-URL: Homepage, https://github.com/antigenomics/vdjtools
Project-URL: Repository, https://github.com/antigenomics/vdjtools
Project-URL: Documentation, https://antigenomics.github.io/vdjtools/
Requires-Python: >=3.10
Requires-Dist: polars>=1.0
Requires-Dist: numpy
Requires-Dist: scipy
Requires-Dist: typer>=0.12
Requires-Dist: arda-mapper>=2.19.0
Requires-Dist: seqtree>=1.0.0
Requires-Dist: vdjmatch>=0.1.2
Requires-Dist: huggingface_hub
Provides-Extra: model
Provides-Extra: overlap
Requires-Dist: scikit-learn; extra == "overlap"
Provides-Extra: preprocess
Provides-Extra: sc
Requires-Dist: scikit-learn; extra == "sc"
Requires-Dist: pyyaml; extra == "sc"
Requires-Dist: anndata; extra == "sc"
Requires-Dist: awkward; extra == "sc"
Requires-Dist: mudata; extra == "sc"
Provides-Extra: interop
Requires-Dist: scirpy; extra == "interop"
Requires-Dist: sc-dandelion; extra == "interop"
Provides-Extra: examples
Requires-Dist: marimo; extra == "examples"
Requires-Dist: matplotlib; extra == "examples"
Requires-Dist: scikit-learn; extra == "examples"
Provides-Extra: oracle
Requires-Dist: olga; extra == "oracle"
Provides-Extra: test
Requires-Dist: pytest>=7.4; extra == "test"
Requires-Dist: pytest-cov; extra == "test"
Provides-Extra: bench
Provides-Extra: docs
Requires-Dist: sphinx>=7; extra == "docs"
Requires-Dist: pydata-sphinx-theme>=0.15; extra == "docs"
Requires-Dist: nbsphinx; extra == "docs"
Provides-Extra: dev
Requires-Dist: ruff; extra == "dev"
Requires-Dist: pytest>=7.4; extra == "dev"
Requires-Dist: pybind11>=2.12; extra == "dev"
Provides-Extra: all
Requires-Dist: scikit-learn; extra == "all"
Description-Content-Type: text/markdown

<p align="center">
  <picture>
    <source media="(prefers-color-scheme: dark)" srcset="assets/vdjtools_dark.svg">
    <source media="(prefers-color-scheme: light)" srcset="assets/vdjtools_light.svg">
    <!-- Absolute PNG fallback: PyPI strips <picture>/<source> and cannot render a relative or
         raw-served SVG, so the logo must be an absolute-URL raster here. GitHub uses the SVG sources. -->
    <img alt="vdjtools" src="https://raw.githubusercontent.com/antigenomics/vdjtools/master/assets/vdjtools_dark.png" width="320">
  </picture>
</p>

<h1 align="center">vdjtools — immune-repertoire analysis</h1>

<p align="center">
  <a href="https://pypi.org/project/vdjtools/"><img alt="PyPI" src="https://img.shields.io/pypi/v/vdjtools"></a>
  <a href="https://github.com/antigenomics/vdjtools/actions/workflows/ci.yml"><img alt="CI" src="https://github.com/antigenomics/vdjtools/actions/workflows/ci.yml/badge.svg"></a>
  <a href="https://docs.isalgo.dev/vdjtools/"><img alt="docs" src="https://github.com/antigenomics/vdjtools/actions/workflows/docs.yml/badge.svg"></a>
  <img alt="python" src="https://img.shields.io/badge/python-3.10%2B-blue">
  <img alt="license" src="https://img.shields.io/badge/license-GPLv3-green">
</p>

TCR/BCR immune-repertoire analysis — a clean-room **Python + C++** rewrite of the legacy
Groovy/Java [vdjtools](https://doi.org/10.1371/journal.pcbi.1004503), standardised on the
**AIRR schema** and **polars** DataFrames with minimal object-orientation.

Built on the antigenomics ecosystem:
[seqtree](https://github.com/antigenomics/seqtree) (fuzzy search / e-value engine),
[vdjmatch](https://github.com/antigenomics/vdjmatch) (overlap + TCRnet),
[arda](https://github.com/antigenomics/arda) (AIRR annotation + markup repair).

> **Status: stable** (version: the PyPI badge above). The native V(D)J model engine plus the
> full analytics suite (diversity,
> overlap/TCRnet, preprocessing, biomarkers, single-cell), **longitudinal clonotype dynamics**
> (paired expansion testing + the VDJtrack recapture model), CDR features, and legacy-format
> ingestion (MiXcr, MiGec, immunoSEQ, IMGT/HighV-QUEST, Vidjil, RTCR, TRUST4, arda). Clonotype
> columns follow the AIRR **junction** convention (`junction_nt` / `junction_aa`). The legacy v1.x
> tool lives on the [`legacy-1.x`](https://github.com/antigenomics/vdjtools/tree/legacy-1.x) branch
> and its releases remain available under the repository tags (`v0.0.1` … `1.2.1`).

## Install

```bash
pip install vdjtools
```

Prebuilt wheels ship for CPython 3.10–3.13 on Linux, macOS (Apple Silicon), and Windows; the
native `_core` C++ extension is bundled (the source distribution compiles it on install).

That one command gives you **everything vdjtools advertises** — no extras to opt into. The three
antigenomics engines it delegates to are **base dependencies**:

| Engine | Powers |
|---|---|
| [arda](https://github.com/antigenomics/arda) | the germline reference (V/D/J + CDR3 anchors), model engine, annotation |
| [seqtree](https://github.com/antigenomics/seqtree) | fuzzy search / e-values → error correction, similarity overlap, TCRnet |
| [vdjmatch](https://github.com/antigenomics/vdjmatch) | sample overlap, TCRnet, metaclonotypes |

So `preprocess.correct()`, `overlap.tcrnet()`, `biomarker.metaclonotypes()` and
`model.reference.load_germline()` all just work from a plain install — and downstream libraries
can depend on plain `vdjtools` and rely on them being there. All three are imported **lazily**, so
`import vdjtools` stays light; between them they add only `requests` on top of what vdjtools
already needs. arda fetches its IMGT reference once, on first use.

Two things are still optional, because each has a working alternative or is a side integration:

```bash
pip install "vdjtools[overlap]"   # scikit-learn — only for cluster_samples(method="mds");
                                  # method="hclust" works out of the box (scipy)
pip install "vdjtools[sc]"        # single-cell: anndata + awkward + mudata (scverse
                                  # bridges), pyyaml (AIRR Cell export)
```

MMseqs2 is needed **only** for arda's alignment/annotation path (`model.stitch.annotate`) — never
for germline lookup, Pgen, generation, or the analytics. Install it via conda/brew if you need it.

### Development

Uses [uv](https://docs.astral.sh/uv/) — one repo-local `.venv`, no conda:

```bash
uv venv && source .venv/bin/activate
uv pip install -e ".[dev,test]"       # builds the _core C++ extension (scikit-build-core)
```

Or run the bootstrap script (portable across bash/zsh, uv-first with a `python -m venv` fallback):

```bash
bash setup.sh --dev-parents --tests   # or: zsh setup.sh
```

You need a C++ toolchain (Xcode CLT on macOS, build-essential on Linux) for the native `_core`
extension. MMseqs2 is arda's aligner, needed **only** for the annotation path and the slow arda
round-trip tests — `brew install mmseqs2`, or use the optional `environment.yml` conda env which
bundles it.

## Where to start

| You want to | Go to |
|---|---|
| Load samples and run diversity / overlap / usage | [Quickstart](#quickstart) · [User guide](https://docs.isalgo.dev/vdjtools/usage.html) |
| Clean, filter, downsample, batch-correct a cohort | [Pre-processing](https://docs.isalgo.dev/vdjtools/preprocessing.html) |
| Pgen, V(D)J markup, generate sequences, fit a model | [Model engine](#recombination-model-engine) · [Models](https://docs.isalgo.dev/vdjtools/model.html) |
| One fixed feature vector per sample, for a classifier | [Repertoire signatures](#repertoire-signatures-extended) · [Signature](https://docs.isalgo.dev/vdjtools/signature.html) |
| Single-cell / 10x / scirpy / Dandelion interop | [Single cell](https://docs.isalgo.dev/vdjtools/singlecell.html) |
| Worked examples as notebooks | [Notebook gallery](https://docs.isalgo.dev/vdjtools/notebooks.html) |

## Quickstart

Read any format, get one canonical AIRR frame, and run the analyses the tool is for:

```python
from vdjtools import io as vio, stats, overlap

sample = vio.read("clones.tsv")                 # MiXcr / immunoSEQ / AIRR / Parquet / native — sniffed
cohort = vio.read_samples(vio.read_metadata("metadata.txt"), base_dir="samples/")

stats.diversity.diversity_stats(sample)         # richness, Chao, Shannon, Simpson, d50
stats.usage.segment_usage(sample, segment="v")  # V / J / VJ usage
stats.spectratype.spectratype(sample)           # junction-length spectrum
overlap.overlap_matrix(cohort)                  # pairwise repertoire overlap
```

The same thing without Python at all:

```bash
vdjtools diversity     sampleA.tsv sampleB.tsv -o diversity.tsv
vdjtools overlap       *.tsv -o overlap.tsv
vdjtools segment-usage -m metadata.txt --base-dir samples/ -t 0 -o usage.tsv
```

## Command line

`pip install vdjtools` installs the `vdjtools` command — the model engine (OLGA/IGoR-style) and the
repertoire analytics (over sample files or a metadata table, like the legacy tool):

```bash
# recombination model engine — built-in models for all 7 loci (no download)
vdjtools models                                # list the bundled models
vdjtools generate -m TRB -n 1000 -o gen.tsv    # sample sequences   (cf. olga-generate_sequences)
vdjtools pgen seqs.tsv -m TRB -o pgen.tsv      # Pgen per CDR3       (cf. olga-compute_pgen)
vdjtools pgen seqs.tsv -m TRB --mismatches 1   # + the Hamming-1 ball; --v-col/--j-col to condition

# model workshop — a model is a directory, or LOCUS[:source[:organism]]
vdjtools model check TRB:learned                     # audit vs its germline; exits 1 on an error
vdjtools model template --locus TRB -o tmpl/         # scaffold from arda, or your own --germline-v/-j
vdjtools model learn clones.tsv -t tmpl/ -o fitted/  # EM on your sequences (--init template = fine-tune)
vdjtools model log fitted/                           # log-likelihood per iteration
vdjtools model diversity TRB:olga                    # entropy + total diversity estimate
vdjtools model compare TRB:olga TRB:learned --by gene --dot diff.pdf
vdjtools model loglik seqs.tsv TRB:learned           # log-likelihood, free parameters, AIC, BIC
vdjtools model extend fitted/ --locus TRB -o bigger/ # add a larger allele library
vdjtools model export TRB:olga --long -o marginals.tsv

# data — convert any format to the canonical table (TSV, or Parquet by extension), preprocess
vdjtools convert mixcr.txt.gz -o clones.parquet   # MiXcr/immunoSEQ/AIRR/… → canonical Parquet
vdjtools downsample clones.parquet 100000 -o ds.tsv

# filtering — THREE SEPARATE AXES, deliberately separate flags:
#   --productive       the REARRANGEMENT encodes a chain   (AIRR: in frame, no stop codon)
#   --functional-genes the GERMLINE GENE is real           (IMGT: F / ORF / P)
#   --min-len/--max-len  junction_aa length, INCLUSIVE     (default sanity bound 5..60)
# A productive rearrangement can still use a pseudogene V — filtering one says nothing
# about the other.
vdjtools filter clones.parquet --productive --min-freq 1e-4 -o productive.tsv
vdjtools filter clones.parquet --nonproductive -o nonproductive.tsv   # isolate them instead
vdjtools filter clones.parquet --functional-genes --keep-orf -o f_orf.tsv
vdjtools filter clones.parquet --productive --keep-frequencies -o kept.tsv  # file's own freqs

# cross-batch V/J-usage bias — correct the usage, and rewrite the clonotype tables
vdjtools correct-vj s1.tsv s2.tsv s3.tsv s4.tsv -b A,A,B,B \
    --transform sigmoid --usage-out usage.tsv --outdir corrected/

vdjtools pool s1.tsv s2.tsv s3.tsv --join --min-samples 2 -o joint.tsv

# repertoire analytics — sample files, or a cohort via -m/--metadata + --base-dir
vdjtools diversity      sampleA.tsv sampleB.tsv -o diversity.tsv
vdjtools overlap        *.tsv -o overlap.tsv
vdjtools segment-usage  *.tsv --segment v -o usage.tsv
vdjtools spectratype    *.tsv -o spectra.tsv
vdjtools diversity      -m metadata.txt --base-dir samples/ --threads 8 -o div.tsv   # parallel cohort
vdjtools spectratype    --cohort cohort_parquet/ -o spectra.tsv                       # one streamed pass

# the portable signature — one fixed, named feature vector per sample (see below)
vdjtools signature      --preset classify -m metadata.txt --base-dir samples/ -o sig.tsv

# longitudinal — paired within-donor expansion test between two timepoints
vdjtools dynamics day0.tsv day15.tsv -o tracked.tsv
```

Native vdjtools, AIRR Rearrangement, Parquet, and third-party inputs are auto-detected; every
command writes to `-o` — **TSV, or Parquet when the path ends in `.parquet` / `.pq`** — or to stdout
(so it pipes). Cohort commands parallelise over samples with `-t/--threads` or stream a pre-ingested
Parquet cohort with `--cohort`. Run `vdjtools <command> --help` for options.

## Analytics (Python API)

Every reader returns one canonical `polars` clonotype frame (AIRR **junction** columns), and every
analysis function takes and returns such frames — so results chain together and drop straight into
plotting. A tour of the analysis modules (full runnable walkthrough in the
[**User guide**](https://docs.isalgo.dev/vdjtools/usage.html)):

```python
from vdjtools import io as vio, stats, features, overlap, preprocess

# load (auto-detects MiXcr / immunoSEQ / AIRR / native / … and converts), or a whole cohort:
sample = vio.read("clones.tsv")
cohort = vio.read_samples(vio.read_metadata("metadata.txt"), base_dir="samples/")

# diversity, rarefaction, segment usage, spectratype
stats.diversity_stats(sample)                 # observed, Chao1, Shannon, inverse-Simpson, d50, …
stats.inext(sample, q=(0, 1, 2))              # Hill-number rarefaction/extrapolation + bootstrap CIs
stats.segment_usage(sample, "v")              # V (or "j") usage;  stats.spectratype(sample)

# CDR3 physicochemistry & k-mers
features.physchem_profile(sample, region="all")

# repertoire overlap & TCRnet (fuzzy/similarity/TCRnet via the [overlap] engine)
overlap.overlap_metrics(sampleA, sampleB)     # F / D / Jaccard / Morisita-Horn …
overlap.tcrnet(sample)                         # per-clonotype neighbourhood enrichment

# preprocessing: downsample to a common depth, error-correct, filter, pool
preprocess.downsample(sample, 100_000)
preprocess.correct(preprocess.filter_productive(sample))

# three filtering axes, kept apart: AIRR productivity, IMGT gene functionality, length
preprocess.filter_productive(sample, recompute_frequencies=False)  # keep the file's freqs
preprocess.filter_functional_genes(sample, keep=("F", "ORF"))      # IMGT axis
preprocess.filter_length(sample, min_len=5, max_len=60)            # inclusive bounds

# cross-batch V/J-usage bias: batch-correct usage, then resample the clonotype table
usage = preprocess.correct_vj_usage(cohort, batch_col="batch", transform="sigmoid")
fixed = preprocess.apply_vj_correction(sampleA, usage, sample_id="A0")
```

The **portable signature** — one repertoire in, a fixed named positional feature vector out, on a
scale a downstream model can consume without fitting a scaler of its own. This is the statistics
half (`vsig`); the geometry half (`rsig`, features of the prototype-sum embedding) is
[mirpy](https://github.com/antigenomics/mirpy)'s `mir.signature`, and the two concatenate on
`sample_id` into one contract:

```python
from vdjtools.signature import vsig, vsig_cohort, columns, describe

v = vsig({"TRB": sample}, tier="standard")    # {column: value}, in frozen layout order
describe("standard")                          # the column dictionary
```

Every feature carries a variance-stabilising transform chosen from its support — Haldane–Anscombe
logit for a proportion, Anscombe arcsine for a share, CLR (*k−1* parts) for a composition, log for
a count — so that a read count, an isotype fraction and a principal component can sit in one
matrix. `core ⊂ standard ⊂ full` are exact **index subsets** of one frozen column order. A locus
that was not sequenced is `nan` plus a `mask:` column, never a zero.

Longitudinal tracking — which clonotypes changed between two timepoints, and the VDJtrack recapture
model (Pavlova, Zvyagin & Shugay 2024):

```python
from vdjtools import dynamics

# paired within-donor test: emergent / expanded / persistent / contracted / vanishing
tracked = dynamics.test_pair(day0, day15)                  # depth handled per-pair (effective N)
grouped = dynamics.test_metaclonotypes(day0, day15, scope="1,0,0,1")  # 1-Hamming CDR3 ball first
called  = dynamics.expansion_test(day0, day15)             # edgeR NB-exact caller (log2FC + p)

# VDJtrack size-bucket recapture model — recapture fraction per clone-size class (Beta bands);
# split by a group column + capture_test() for the group effect (see examples/vaccination_tracking.py)
rates = dynamics.capture_rates(pre, post)
```

Incidence-based clonotype association (Emerson 2017 / Howie 2015 / De Witt 2018 / Vlasova 2026)
— a choice of test, condition, and co-occurrence — and single-cell paired-chain Pgen:

```python
from vdjtools import biomarker, sc
from vdjtools.biomarker import association, condition

# feature vs condition: Fisher / chi2 / Bayesian / permutation; binary, per-HLA-allele, or CMH-stratified
association(cohort, condition.binary(meta, "cmv"), test=["fisher", "bayes_bf"])
association(cohort, condition.stratified(meta, "cmv", "hla"), stratum_col="_stratum")  # CMV | HLA (CMH)

# feature vs feature: in-silico α-β pairing / same-chain co-specificity (θ lift + Fisher + FDR)
biomarker.cooccurrence(cohort, chain_a="TRA", chain_b="TRB", evalue=True)

sc.paired_pgen(sc.pair_chains(sc.read_10x("filtered_contig_annotations.csv")))  # pgen_alpha·pgen_beta
```

## Repertoire signatures (extended)

An **optional** layer on top of the analytics above, for when the question is a *model* rather than
a statistic: one AIRR sample in, one fixed-width, named, already-standardised feature vector out —
so your matrix and a collaborator's are the same coordinate system, computed independently, with no
scaler of your own.

```bash
vdjtools signature --preset classify -m metadata.txt --base-dir samples/ -o vsig.tsv
vdjtools presets                       # the named feature sets, ranked
vdjtools signature --describe          # the exact columns, reading no input
vdjtools signature --channels          # the channel vocabulary — what each group of columns measures
```

```python
from vdjtools.signature import vsig, vsig_cohort, channels, describe
```

Columns are `<sig>:<channel>:<locus>:<feature>`, and the tiers `core` (152) ⊂ `standard` (688) ⊂
`full` (1403) are exact index subsets of one frozen order. The second field is the **channel** — the
named group of columns that measures one thing, and the level a finding is stated at ("the groups
separate in IGH diversity"). Twenty channels cover the whole vector.

This command emits the statistics half (`vsig`). The geometry half (`rsig`) needs the prototype
embedding and lives in [mirpy](https://github.com/antigenomics/mirpy) — `mir signature` emits both
as one vector, which is usually what you want.

Full documentation, including which scale reference to use and what "weighted" means:
[**Signature**](https://docs.isalgo.dev/vdjtools/signature.html) ·
[**Channels**](https://docs.isalgo.dev/vdjtools/channels.html)

## Recombination model engine

Precomputed models for all **7 human loci** ship in the wheel — no OLGA or download needed:

```python
from vdjtools.model import load_bundled, native
from vdjtools.model.generate import generate

model = load_bundled("TRB", source="olga")     # or source="learned" (fit to real repertoires)

native.pgen_nt(model, "TGTGCCAGCAGC...")        # nucleotide generation probability (native C++)
native.pgen_aa(model, "CASSLAPGATNEKLFF")       # amino-acid Pgen (codon-marginalised)
native.pgen_aa(model, "CASSLAPGATNEKLFF", mismatches=1)   # + the whole Hamming-1 ball
native.pgen_aa_batch(model, seqs, mismatches=1, threads=0)  # Pgen over many CDR3s, thread-parallel (~11×)
generate(model, 1000, seed=1)                    # sample a repertoire -> polars DataFrame
                                                # seed= is process-stable from 3.3.0
```

Where Pgen *sums* over recombination scenarios, `model.viterbi` takes the **argmax** — the single
most likely one, which is the V/D/J boundary markup:

```python
from vdjtools.model import best_scenario

sc = best_scenario(model, "TGTGCCAGCAGCTTAGGGACAGGGGGCTACGAGCAGTACTTC",
                   v="TRBV19*01", j="TRBJ2-7*01")     # ALLELE names, as the model's tables are

sc.v_end, sc.d_call, sc.d_start, sc.d_end, sc.j_start   # 0-based, half-open, in CDR3-nt space
# -> 8, 'TRBD1*01', 15, 24, 26
```

It reuses the same tables and the same loops as `pgen_nt`, so the chosen D obeys `P(D|J)` — a
TRBD2–TRBJ1 pair is genomically impossible and cannot be called.

`infer_nt` goes the other way, reconstructing a **nucleotide** CDR3 from an amino-acid one — the
VDJdb case, where a record carries `(V, J, CDR3aa)` and no nucleotides:

```python
from vdjtools.model import infer_nt

sc = infer_nt(model, "CASSLGQAYEQYF", v="TRBV5-1*01", j="TRBJ2-3*01")
sc.cdr3_nt, sc.pgen, sc.margin        # sequence, its exact Pgen, and how far ahead of the runner-up
```

Germline positions are pinned to their segment; each free N-region position takes the nucleotide the
insertion model prefers. It reproduces the exponential brute-force oracle exactly on every record
the oracle can resolve (25/25 TRG, 19/19 TRA) — fixing the germline trim first and then picking the
best codon per residue only manages 9/25 and 4/19, because a trim chosen before the codons pins a
codon the true optimum would have trimmed away.

The search is native (the same Pi_L·Pi_R transfer matrix as `pgen_aa`, with `max` for the sums):
**2.5 ms per human TRB CDR3, 0.5 ms per TRA** — all 80k VDJdb records in about 3 minutes. `v=`/`j=`
take one allele, several (a list or the comma-separated string an ambiguous `v_call` carries), or
nothing at all, in which case the DP marginalizes over every gene at essentially no extra cost.

Matches OLGA's Pgen to machine precision across all 7 loci, and adds tandem-D (D-D) support that
OLGA/IGoR lack. Learn a model from your own **non-functional** reads (out-of-frame *or* stop-codon
— both escaped
selection, which is all a generative model needs) with `model.infer.infer_native`.

Explore any model's recombination **Bayes net** interactively (entropy, mutual information, marginals):

```bash
pip install "vdjtools[examples]"
marimo edit examples/model_explorer.py
```

Interactive **marimo** notebooks (data auto-loads from HuggingFace, or a local `~/hf/` copy):

- `examples/vaccination_tracking.py` — clonotype **tracking** + the recapture model across
  yellow-fever / influenza / TBE vaccination time courses (`vdjtools.dynamics`).
- `examples/aging.py` — cohort-**streaming** diversity, clone-size and spectratype vs age.
- `examples/ankspond_motif.py` — the ankylosing-spondylitis TRBV9 **"AS27" motif**: disease vs HLA-B27 carriage.
- `examples/biomarker_explorer.py` — Emerson public-TCR association + co-occurrence.

## Performance

The Pgen / generation / EM / diversity hot paths are a native C++ (pybind11) core; everything else is
polars. Amino-acid Pgen matches OLGA to machine precision (1e-15) across all 7 loci while being
several times faster, and the built-in models keep the resident set small. Single thread, Apple M3
(arm64), bundled human TRB model:

| operation | throughput | vs OLGA |
|---|---|---|
| nucleotide Pgen (single-D VDJ) | **~0.5 ms/seq** | **9×** |
| amino-acid Pgen | **~0.6–0.9 ms/seq** | **8.6×** |
| Pgen + Hamming-1 ball (1 substitution) | **~15 ms/seq** | **8.7×** |
| sequence generation | **~32 000 seq/s** | — |

Nucleotide Pgen (via the same transfer-matrix DP as the aa path — an in-frame CDR3 is an aa query with
one codon fixed per position) is exact vs OLGA across all loci. Batched Pgen / 1-mismatch over many
CDR3s parallelises over sequences (`native.pgen_aa_batch`, **~11× on 16 cores**, bitwise-identical to
the serial result); the EM E-step parallelises over reads (~6.7× on 8 threads); diversity/rarefaction
run on a native iNEXT kernel (bootstrap + parallel batch). Memory stays light — **~63 MB**
resident for `import vdjtools` plus one loaded model, **~123 MB** with all seven bundled models
resident. Reproduce the in-repo half with `RUN_BENCHMARK=1 pytest tests/python -k benchmark`;
the standalone Pgen harness lives in the separate `2026-vdjtools-benchmark` repository.

## Capabilities

Reference: the [User guide](https://docs.isalgo.dev/vdjtools/usage.html) walks through every
module with runnable examples; the [API reference](https://docs.isalgo.dev/vdjtools/) documents
every symbol.

- **IO** — canonical clonotype frame on AIRR **junction** columns (`junction_nt` / `junction_aa`);
  readers for native vdjtools, AIRR Rearrangement TSV, and Parquet, plus format-detecting converters
  for MiXcr (v1/2 + v3/4, incl. C-gene / BCR isotype), MiGec, Adaptive immunoSEQ (v1/v2),
  IMGT/HighV-QUEST, Vidjil, RTCR, TRUST4, and arda AIRR output
  ([`vdjtools.io.convert`](python/vdjtools/io/convert.py)); metadata-driven batch + hive-partitioned cohorts.
- **Model** — native V(D)J recombination model: generation probability (Pgen — nt, aa,
  1-mismatch, V/J-agnostic, **thread-parallel batch**), sequence generation, and EM inference, all in a
  native (pybind11) core. Supersedes OLGA and IGoR: arda-driven scenario enumeration, polars marginal
  tables, read-parallelised EM, and **tandem-D (D-D)** support. Concordant with OLGA across all 7 loci;
  precomputed OLGA + real-data-learned models bundled ([`load_bundled`](python/vdjtools/model/bundled.py)).
- **Model workshop** ([user guide](https://docs.isalgo.dev/vdjtools/model.html)) — build a model on
  **your own V(D)J germline library** (`from_germline`, FASTA + anchors) and fit it to **your own
  sequences**; export and re-import every marginal as tables; **check** a model against its germline
  (`check_model` — functional genes stuck at P=0, unreachable deletion mass, incomplete conditionals);
  read the **EM training log** and per-iteration likelihood; **compare two models** (per-event
  Jensen-Shannon / total variation, gene usage, a bnlearn-style comparison graph) and their **Pgen
  distributions**; compute **log-likelihood, AIC and BIC** of a clonotype set under a model;
  **fine-tune** it, **extend** it with a larger allele library, and **re-weight V/J usage** for
  protocol bias. Plus information content per recombination event and a **total diversity estimate**
  (human TRB: ~52 bits per rearrangement, ~45 bits per sequence, ~3·10¹³ effective sequences).
- **Stats** — diversity (Chao1/Shannon/Simpson/…), spectratype, V/J/VJ usage.
- **Features** — CDR physicochemical profiles, k-mer / V+k-mer summaries.
- **Overlap** — sample overlap and TCRnet (via vdjmatch/seqtree), similarity-aware overlap, clustering.
- **Preprocess** — downsampling, error-correction, VJ-usage batch-effect correction, pooling/joining.
- **Biomarker** — incidence association (Fisher / χ² / Bayesian / permutation) against binary,
  per-HLA-allele or CMH-stratified conditions; α-β and same-chain co-occurrence pairing;
  metaclonotypes.
- **Dynamics** — longitudinal clonotype tracking between timepoints: the paired within-donor
  expansion test (emergent / expanded / persistent / contracted / vanishing), the VDJtrack
  size-bucket **recapture model**, metaclonotype-grouped testing, and an edgeR NB-exact caller
  ([`vdjtools.dynamics`](python/vdjtools/dynamics)).
- **Single-cell** — CellRanger / AIRR Cell / arda ingestion, chain pairing + doublet & mispairing
  QC, paired α/β Pgen, clustering evaluation, and **round-trip interop** with the downstream
  single-cell stack ([`vdjtools.sc`](python/vdjtools/sc), [guide](docs/singlecell.rst)).

  | Ecosystem | Out | Back in | Needs |
  |---|---|---|---|
  | [scirpy](https://github.com/scverse/scirpy) / scverse | `to_scirpy` (scirpy's `obsm["airr"]`, or a `MuData` with GEX) | `from_scirpy` | `scirpy` out; only `awkward` back |
  | [dandelion](https://github.com/tuonglab/dandelion) | `to_dandelion` | `from_dandelion`, `read_h5ddl` | `sc-dandelion` out; only `h5py` back |
  | [scRepertoire](https://github.com/BorchLab/scRepertoire) (R) | `write_screpertoire` (AIRR or 10x shaped) | — | nothing |
  | Any AIRR consumer | `to_airr` / `write_airr` | `from_airr`, `read_airr_cell` | nothing |

  All four read the same thing — a flat AIRR Rearrangement table with `sequence_id` + `cell_id` —
  so there is one emitter and one inverse, and each bridge is a thin adapter. Writing a container
  delegates to the library that owns it (no stale copy of someone else's schema to drift); reading
  one is ours, so a result handed to you is always openable. `push_obs` pushes a vdjtools-computed
  column (`pgen_paired`, mispairing flags) onto an `AnnData.obs` or `Dandelion.metadata` you did
  not build. CLI: `vdjtools sc convert|pair|qc|pgen|export`.

## License

GPL-3.0-or-later.
