pYPKa_A_SsXYL1

Plan for the construction of E. coli vector pYPKa_A_SsXYL1

Step 1 PCR of the insert

PCR with primers pfw957 & prv957 and template SsXYL1_template results in a 959bp PCR product

Primers annealing on template:

  5ATGCCTTCTATTAAGTTGAA...AAGATTCCTATCTTCGTCTAA3
                          ||||||||||||||||||||| tm 45.3 (dbd) 55.5
                         3TTCTAAGGATAGAAGCAGATT5
5aaATGCCTTCTATTAAGTTGAA3
   |||||||||||||||||||| tm 43.8 (dbd) 54.9
  3TACGGAAGATAATTCAACTT...TTCTAAGGATAGAAGCAGATT5

Suggested PCR programs for Taq polymerase and for Polymerases with DNA binding domain:

Taq (rate 30 nt/s)
Three-step|         30 cycles     |      |SantaLucia 1998
94.0°C    |94.0°C                 |      |SaltC 50mM
__________|_____          72.0°C  |72.0°C|
04min00s  |30s  \         ________|______|
          |      \ 54.0°C/ 0min28s|10min |
          |       \_____/         |      |
          |         30s           |      |4-8°C

Pfu-Sso7d (rate 15s/kb)
Three-step|          30 cycles   |      |Breslauer1986,SantaLucia1998
98.0°C    |98.0°C                |      |SaltC 50mM
__________|_____          72.0°C |72.0°C|Primer1C   1µM
00min30s  |10s  \ 55.0°C ________|______|Primer2C   1µM
          |      \______/ 0min14s|10min |
          |        10s           |      |4-8°C

Step 2 Vector digestion and cloning

Clone the PCR product in pYPKa digested with AjiI resulting in pYPKa_A_SsXYL1

Step 3 Diagnostic PCR confirmation

Confirm the structure of the pYPKa_A_SsXYL1 using primers 468, 342 and pfw957 in a multiplex PCR reaction.

Expected PCR products sizes from 468, 342 and pfw957 (bp):

pYPKa with insert in correct orientation: 1725, 1675
pYPKa with insert in reverse orientation: 1725, 1009
Empty pYPKa clone : 766