Pre-processing data to use with itpseq

Pre-requisite

The pre-requisite to use itpseq is to have one fastq file per replicate.

The fastq files are text files with four lines per read:

@E00490:646:H7HGCCCX2:8:1101:5203:2206 1:N:0:CACGAT
GTATAAGGAGGAAAAAATATGCCAGCATCCGTCTAGTCCACGCGGTATCTCGGTGTGACTGACTGAGAATTTCTGTAGGCACCATCAAT
+
\V\MaMDRe``jVeVo``JJV\`VRNVNM9\eHf`RIRjkaV\\fjoo\eoaojjssoVosVVkaaVsssssVsfojossee`j\jeeM

If paired-end sequencing was performed, it is necessary to merge the files. To be able to automatically import the files in a DataSet, it is best to follow a naming convention.

Merging paired-end sequencing files

In case of paired-end sequencing, it is first necessary to pair the two reads. This can be done using tools such as PEAR or Pandaseq.

For instance, with PEAR, assuming a forward nnn15_noa1_1.fastq and reverse nnn15_noa1_2.fastq, those can be merged into a single nnn15_noa1.assembled.fastq using:

pear -u0 -c126 -f nnn15_noa1_1.fastq -r nnn15_noa1_2.fastq -o nnn15_noa1

After pairing of the reads, a dataset with a control (noa) and an antibiotic-treated condition (tcx), with 3 replicates each might look like:

nnn15_noa1.assembled.fastq
nnn15_noa2.assembled.fastq
nnn15_noa3.assembled.fastq
nnn15_tcx1.assembled.fastq
nnn15_tcx2.assembled.fastq
nnn15_tcx3.assembled.fastq

Naming conventions

itpseq relies on filenames to match and load data files. Although not strictly required we recommend to use filenames without spaces and with short descriptors of the sample properties and groups.

For instance, we use nnn15 as a prefix to indicate that a random NNN15 library was used. In case of an antibiotic treatment vs no-antibiotic control we use noa for the control and a short identifier such as tcx for the antibiotic-treated samples. We use a number to indicate the replicate. A filename for the second replicate of an erythromycin-treated sample, with a NNN15 library might be named nnn15_ery2.assembled.fastq.

During the analysis, itpseq can combine automatically the replicates into a Sample, and assign a reference to it. See Loading iTP-Seq data for more details.