WebLogo BETA               · about · create · examples ·

Logo Creation Form Help

Multiple Sequence Alignment
Enter your sequence information here. There are three formats to choose from; FASTA, CLUSTALW, and flat. In all cases, lines beginning with "#" are comment lines and have no effect on the output logo. All sequences must be the same length.

FASTA format:
  >name1 (optional)
  acgtacgtacgtacgtacgattca
  >name2 (optional)
  tacgtacgatcgatcgtgactacg
  >name3 (optional)
  actgactagctactagctactacg
  ... 
  >nameN (optional)
  actgactagctagcatcgactgac

CLUSTALW format:
  name1line1      atcgagttatcgcgaggagaggcgcgtacgatcgatcgatcgatgcatgcatcgatcgatgctataatacgatgctagca
  name2line1      tacgtacgatcgatcgtgactacgactgatcgatgcatcgatgctagctagctagctagctagctagcatgctagctagc
  ...
  nameNline1      actgactagctagcatcgactgacactgactgactgatcgatcgatcgatcgatcgatcgatcgatcgatcgtagtagtg
  name1line2      atgcatcgacacacatgtgtgatcattatagagcgctagcatgcatgctagatcgtacgtacgtacgtacgtacgattca
  name2line2      tacgtacgatcgatcgtgactacgatgcatgcatcgcggatatatagagagatctatcgcatcgatcgatcgatcgatcg
  ...             atcgagttatcgcgaggagaggcgcgtacgatcgatcgatcgatgcatgcatcgatcgatgctataatacgatgctagca
  nameNline2      actgactagctagcatcgactgacatcgatcgatcgatcgatcgatcgatcgatcgatcgatcgatcgatgctagctagc
  ...
  ...
  name1lineM      acgtacgtacgtacgtacg
  name2lineM      tacgtacgatcgatcgtga
  ...
  nameNlineM      actgactagctagcatcga

Flat format (each sequence must be of same length):
  sequence1
  sequence2
  sequence3
  ...
  sequenceN
Sequence Type
Sequence data can be of "amino acid" or "DNA/RNA". Choose "Automatic Detection" to have Weblogo choose for you, based on the entered data (if 90% or more of the entered data are a, c, t or g residues, then Weblogo chooses DNA/RNA.
Label Sequence Ends
Choose this option to label the 5' & 3' ends of nucleic acid or the N & C termini of amino acid sequences.
First Position Number
The numerical label of the first residue in the multiple sequence alignment. The label must be an integer. Residue labels for the logo will be relative to this number. (See also: Logo Range)
Logo Range
By default, all sequence data is displayed in the Sequence Logo. With this option, you can instead show a subrange of the entire sequence. Start and end positions are included, and the numbering of positions is relative to the sequence number of the first position. (See also: First Position Number ) Thus, if the first position number is "2", start is "5" and end is "10", then the 4th through 9th (inclusive) sequence positions will be displayed, and they will be numbered "5", "6", "7", "8", "9" and "10".
Frequency Plot
Show residue frequencies, rather than information content.
Small Sample Correction
When there are only a few sample sequences a straightforward calculation will tend to overestimate the entropy. To compensate, this option will subtract an approximation of this bias from the total entropy. This small sample correction depends only on the number of symbol types (4 for RNA/DNA, 20 for protein) and the total amount of data in each column, which may differ from one column to another, since some columns will contain more gaps, and less data.
Multiline Logos
A multiline Logo will split the sequence across several lines, instead of cramming all of the sequence within the single line width specified above. The Logo height specified at the top of the form becomes the height of each Logo line. The number of logo characters per line can be specified.
Error Bars
The total height of the error bar is twice the small sample correction.
Image Format
The logo can be output in several formats. The following are currently supported: Generally speaking, vector formats (EPS and PDF) are better for printing, while bitmaps (GIF and PNG) are more suitable for displaying on the screen, or embedding into a web page.
Logo Size
Physical dimensions of output logo in centimeters, inches, pixels, or points.
Bitmap Resolution
Typical values are 72 pixels/inch for screen display under Mac OS, 96 pixels/inch for screen display under Windows and 300 or 600 pixels/inch for output to a laser printer.
Antialias Bitmaps
Antialiasing smoothes the rough edges on a bitmap. You may wish to disable this feature if, for example, you intend to further edit the bitmap.
Title
Give your logo a title.
Y-axis Height
Specify the number of bits on the y axis. By default, the height of the y-axis is the maximum entropy for the given sequence type. (log2 4 = 2 bits for DNA/RNA, log2 20 = 4.3 bits for protein.)
Show Y-Axis
The vertical axis indicates the information content of a sequence position, in bits. Use this option to toggle the y-axis and its bit labels.
Y-Axis Label
Give your y-axis a name. The default label for the y-axis is "bits".
Show X-Axis
The horizontal axis indicates the residue number. Use this option to toggle the x-axis and its labels.
X-Axis Label
Customize your x-axis's label. The default is no label.
Boxed Symbols
It is sometimes useful to outline logo residues with boxes. Use the the shrink factor to decrease the residue size by the factor specified. The default shrink factor is 0.5, meaning halve the residue size.
Outline
By default, the logo residues are filled. Use this option to get outlined (non-filled) residues.
Color Scheme
The default colors for nucleic acids are G, orange; T & U, red; C, blue; and A, green. Amino acids are colored according to their chemical properties: polar amino acids (G,S,T,Y,C,Q,N) are green, basic (K,R,H) blue, acidic (D,E) red and hydrophobic (A,V,L,I,P,W,F,M) amino acids are black. Alternatively, the Black & White option will color all symbols black, or the default color scheme can be overridden with the custom colors specified below.
Symbols
Specify the residue letters here. The symbols are case insensitive. No repeated residues are allowed.
Colors
Choose the color to give the residues specified in "Symbols" . Use the drop-down list to:
    * choose a pre-defined color (Black, Red, Green, Blue, Yellow, Purple, or Orange) or
    * choose "RGB=>" and specify an appropriate RGB color in the "RGB" field.
RGB
If you chose "RGB=>" in the "Colors" field, specify standard hexadecimal colors here (e. g. FF0000 for pure red, 006666 for Slashdot green).




















































logo@The Holy Science Palace