Metadata-Version: 2.1
Name: crispr-ambiguous-mapping
Version: 0.2.2
Summary: Hamming-distance-based CRISPR guide RNA mapping with IUPAC-ambiguous base-editor support.
Author: Basheer Becerra
Author-email: bbecerr@outlook.com
Requires-Python: >=3.8,<3.12
Classifier: Programming Language :: Python :: 3
Classifier: Programming Language :: Python :: 3.8
Classifier: Programming Language :: Python :: 3.9
Classifier: Programming Language :: Python :: 3.10
Classifier: Programming Language :: Python :: 3.11
Requires-Dist: anndata (>=0.11.1,<0.12.0)
Requires-Dist: biopython (>=1.81,<2.0)
Requires-Dist: click (>=8.1,<9.0)
Requires-Dist: matplotlib (>=3.7.1,<4.0.0)
Requires-Dist: numpy (>=1.24.4,<2.0.0)
Requires-Dist: pandarallel (>=1.6.4,<2.0.0)
Requires-Dist: pandas (>=1.5.3,<2.0.0)
Requires-Dist: pyarrow (>=11,<22)
Requires-Dist: pysam (>=0.22.1,<0.23.0)
Requires-Dist: scipy (>=1.10.1,<2.0.0)
Requires-Dist: seaborn (>=0.13.2,<0.14.0)
Requires-Dist: typeguard (>=3.0.2,<4.0.0)
Description-Content-Type: text/markdown

![PyPI - Version](https://img.shields.io/pypi/v/crispr-ambiguous-mapping)

# CRISPR-Correct

**CRISPR-Correct** (Python package `crispr-ambiguous-mapping`) was developed by the *Pinello Lab* as an easy-to-use Python package for performing guide-RNA mapping from raw FASTQs against a guide-library DataFrame. Specifically, CRISPR-Correct handles **imperfect mapping** — either from self-editing by SpRY-based base-editors or sequencing errors — by mapping observed protospacer sequences to the guide RNA with the closest Hamming distance. It cannot handle indels in the protospacer (for that, consider the *Pinello Lab* tool [CRISPR BEAN](https://github.com/pinellolab/crispr-bean)). If you aren't expecting self-editing or sequencing error, this tool still works but [CRISPR SURF](https://github.com/pinellolab/CRISPR-SURF/) may be faster.

CRISPR-Correct also handles guide-RNA **sensor / surrogate constructs**, **UMIs**, and **single-cell sample barcodes** (see **Figure 1**). Mapping is performed on each protospacer / surrogate / barcode permutation and the editing outcomes at the protospacer and surrogate are characterized. You provide regex strings or positional specifications for extracting each component from the read.

<img src="https://github.com/user-attachments/assets/e79e2dc2-ae96-4328-a1b8-06c9ec7a36ae" alt="CRISPR-CLEAR framework" width="300"></img>

*Figure 1. Schematic of a guide-RNA sensor construct. Typically, the expressed guide RNA edits both the endogenous target site and the surrogate target site. A short barcode distinguishes between similar protospacer / surrogate sequences in the guide-RNA library. Paired-end sequencing is performed to capture the protospacer (R1) and the surrogate + barcode (R2).*

If you are mapping many large samples that would take too long on a personal computer, CRISPR-Correct can also run on the [Broad Institute's Terra Platform](https://terra.bio/). The workflow file is at the [Terra Firecloud repository](https://portal.firecloud.org/?return=terra#methods/pinellolab/CrisprSelfEditMappingOrchestratorWorkflowSampleEntity/2).

## What's new in 0.2.0

- **High-level `api`** — a small, stage-aligned interface that most users should start from: `map_fastq` → `count` → `alleles`, plus durable `save` / `load`. A `ParsingConfig` dataclass bundles the ~50 parsing/threshold options into one IDE-friendly object, and a `MatchTier` string-enum gives type-safe tier names. Importable either as `crispr_ambiguous_mapping` or via the forward-looking alias `import crispr_correct as cc`.
- **Slim results by default** — `retain_inference_results=False` is now the default, so the returned object holds just the counts + QC + config. Result pickles shrink ~15× (≈ −93% at simulation scale). Pass `retain_inference_results=True` only when you need allele/mutation post-processing.
- **Flat-arg command-line interface** — a `crispr-correct` console script with `map` / `count` / `save` / `load` / `alleles` subcommands; every `ParsingConfig` field maps 1:1 to a `--flag` (no YAML, no config file).
- **Cross-language durable serialization** — `save` / `load` round-trip the count series, QC summary, and `CountInput` through a parquet + JSON directory readable from Python / R / Julia.
- **Much faster + leaner** — the counter-series build went from ~21,317 s to ~53 s (~400×) on the AVITI 100k-read profile; end-to-end benchmarks improved −36–43% wall time and −33–57% peak RSS (cumulative Phase 1–5).

> **Migrating from 0.0.x?** Several keyword arguments were renamed for clarity — `contains_surrogate` / `contains_barcode` / `contains_umi` → `contains_guide_surrogate` / `contains_guide_barcode` / `contains_guide_umi`, and (earlier) `barcode_*` / `umi_*` → `guide_barcode_*` / `guide_umi_*`. See `../USAGE.md §6` for the full rename table and `CHANGELOG.md` for the accumulated 0.0.236 → 0.2.0 changes (new API surface, CLI, parquet save/load, memory + performance deltas).

## Installation

```bash
pip install crispr-ambiguous-mapping
```

Development install (for contributing):

```bash
git clone https://github.com/pinellolab/CRISPR-Correct.git
cd CRISPR-Correct/crispr-ambiguous-mapping
pip install -e .
```

Python constraint: **`>=3.8, <3.12`**.

### System requirements

Any OS that can run a supported Python version. Multi-core CPU recommended (the inference step parallelizes via `multiprocessing.Pool`); sufficient RAM for in-memory Counter of unique observed sequences; SSD recommended for large FASTQ I/O. `pandarallel`, `biopython`, `pysam`, `anndata`, `click` (CLI), and `pyarrow` (parquet save/load) are pulled in as dependencies.

---

## Prepare inputs

The three inputs are:

1. **Demultiplexed R1 (and R2) FASTQ(s).** See the tip below if your reads arrive with in-read indices that need extra demultiplexing.
2. **Guide library TSV** with columns `protospacer` (required), `surrogate` (optional), `barcode` (optional). Lengths may differ per column but must be uniform within a column.
3. **Parsing specifications** that tell the tool where each component lives within each read (or the FASTQ header).

**Tip:** if indices need to be parsed out of the read before demultiplexing (i.e. in-read indices), use [UMItools](https://github.com/CGATOxford/UMI-tools) and [BBMap demuxbyname](https://github.com/BioInfoTools/BBMap/blob/master/sh/demuxbyname.sh). A [Terra Firecloud method](https://portal.firecloud.org/?return=terra#methods/pinellolab/CrisprMillipedeGuideDemultiplex/5) runs both.

### Guide library TSV (example)

```
protospacer            surrogate                         barcode
TGTCGTGAGGTAGCTACGAC   CAGCAATGTCGTGAGGTAGCTACGACTTGTCA  GCTC
AGTCGTAGCTACCTCACGAC   ATGACAAGTCGTAGCTACCTCACGACATTGCT  GTTG
CCTAGTGGTTATTCGATGTC   AGGTTACCTAGTGGTTATTCGATGTCTCAGAA  CGAA
...
```

### Header regexes (example)

Suppose UMI-tools put the sample barcode + UMI into the FASTQ header:

```
@lh00134:140:225VLGLT3:7:1101:1028:1080_ANGC_GGCA 1:N:0:GAAATAAG+ACGTCCTG
```

- Guide barcode regex: `r"_([^_ ]+)[\s+]"` captures `GGCA`
- UMI regex (8 bp UMI variant): `r":([^+:]{8})(.{2})\+"` captures `GAAATAAG`
- UMI regex (6 bp UMI variant): `r":([^+:]{6})(.{2})\+"`

### Hamming thresholds

For a 20 bp protospacer, 32 bp surrogate, and 4 bp barcode, these defaults work well across published CRISPR-Correct runs:

```python
PROTOSPACER_HAMMING_THRESHOLD = 7
SURROGATE_HAMMING_THRESHOLD   = 10
BARCODE_HAMMING_THRESHOLD     = 2
```

These are guidelines for a canonical base-editor editing window. As long as numbers are not too low (which would discard true edits) or too high (which would bring in random reads), they don't need fine tuning.

---

## Running the guide mapping

### High-level API (recommended)

The quickest way in is the `api` module — `map_fastq` runs the mapping, `count` pulls out the per-tier count container, and `alleles` does allele post-processing. It's exposed at the top level of both `crispr_ambiguous_mapping` and the forward-looking alias `crispr_correct`:

```python
import crispr_correct as cc          # equivalently: import crispr_ambiguous_mapping as cam
import pandas as pd

lib = pd.read_table("guide_library.tsv")

# Bundle the parsing/threshold options into one IDE-friendly object...
cfg = cc.ParsingConfig(
    protospacer_start_position=0, protospacer_length=20, is_protospacer_r1=True,
    revcomp_protospacer=False, protospacer_hamming_threshold_strict=7,
    cores=8,
)

result = cc.map_fastq(lib, ["sample_R1.fastq.gz"], config=cfg)   # extra keyword **overrides also accepted
counts = cc.count(result)                                        # the per-tier count-Series container

# MatchTier is a str-enum of the six tiers (str-equal to the underlying name)
series = getattr(counts, cc.MatchTier.PM).ambiguous_accepted_umi_collapsed_counterseries
series.head()
```

- **`map_fastq(library, fastq_r1_fns, fastq_r2_fns=None, *, config=ParsingConfig(...), **overrides)`** — thin wrapper over the full entry point below. Pass options via `config=` and/or as direct keyword `**overrides`.
- **`ParsingConfig`** — dataclass bundling the ~50 per-component parsing + threshold fields (same names as the full function below; all default to `None` except `retain_inference_results=False` and `cores=1`).
- **`MatchTier`** — `str` enum with members `PM`, `PM_SM`, `PM_BM`, `PM_SM_BM`, `PM_MISMATCH_SM`, `PM_MISMATCH_SM_BM`. Because it subclasses `str`, `cc.MatchTier.PM_SM_BM == "protospacer_match_surrogate_match_barcode_match"` and `str(tier)` returns the underlying tier name (handy for `getattr`).
- **`count(result)`** — returns `result.all_match_set_whitelist_reporter_counter_series_results`.
- **`alleles(result, tier, *, contains_guide_surrogate, contains_guide_barcode, contains_guide_umi)`** — allele extraction for a tier; raises a clear `ValueError` if the result is slim (run with `retain_inference_results=True` first).
- **`save(result, directory)` / `load(directory)`** — durable parquet + JSON serialization (see *Saving + reloading* below).

### Full parameter reference (fine-grained entry point)

```python
from crispr_ambiguous_mapping.mapping import get_whitelist_reporter_counts_from_fastq
```

`map_fastq` is a wrapper over this function; call it directly when you want every knob in one signature. It accepts a guide-library DataFrame, one or more R1 FASTQ paths, optional R2 FASTQ paths, a per-component parsing spec (regex **or** left/right flanks **or** fixed start/end positions), location flags (R1 body / R2 body / FASTQ header), reverse-complement flags, per-component Hamming thresholds, and parallelism controls:

```python
def get_whitelist_reporter_counts_from_fastq(
    whitelist_guide_reporter_df,
    fastq_r1_fns,                      # list of R1 FASTQ paths
    fastq_r2_fns=None,                 # optional list of R2 FASTQ paths

    # Parsing -- per component, ONE of: regex, left+right flank, start+end position
    protospacer_pattern_regex=None,
    surrogate_pattern_regex=None,
    guide_barcode_pattern_regex=None,
    guide_umi_pattern_regex=None,
    sample_barcode_pattern_regex=None,

    protospacer_left_flank=None,       protospacer_right_flank=None,
    protospacer_start_position=None,   protospacer_end_position=None,
    protospacer_length=None,

    surrogate_left_flank=None,         surrogate_right_flank=None,
    surrogate_start_position=None,     surrogate_end_position=None,
    surrogate_length=None,

    guide_barcode_left_flank=None,     guide_barcode_right_flank=None,
    guide_barcode_start_position=None, guide_barcode_end_position=None,
    guide_barcode_length=None,

    guide_umi_left_flank=None,         guide_umi_right_flank=None,
    guide_umi_start_position=None,     guide_umi_end_position=None,
    guide_umi_length=None,

    sample_barcode_left_flank=None,    sample_barcode_right_flank=None,
    sample_barcode_start_position=None, sample_barcode_end_position=None,
    sample_barcode_length=None,

    # Location flags -- where does each component live?
    is_protospacer_r1=None,    is_surrogate_r1=None,
    is_guide_barcode_r1=None,  is_guide_umi_r1=None,   is_sample_barcode_r1=None,

    is_protospacer_header=None,   is_surrogate_header=None,
    is_guide_barcode_header=None, is_guide_umi_header=None, is_sample_barcode_header=None,

    # Reverse complement (usually True for any component read off R2)
    revcomp_protospacer=None,    revcomp_surrogate=None,
    revcomp_guide_barcode=None,  revcomp_guide_umi=None,   revcomp_sample_barcode=None,

    # Hamming thresholds (pass-through to the internal Hamming matcher)
    surrogate_hamming_threshold_strict=None,
    guide_barcode_hamming_threshold_strict=None,
    protospacer_hamming_threshold_strict=None,

    # Output control -- NEW
    retain_inference_results=False,    # see "Slim vs full output" below

    # Internal
    store_intermediates=False,
    cores=1,
) -> WhitelistReporterCountsResult
```

**Parameter naming conventions:**

- `fastq_r1_fns` / `fastq_r2_fns` — always **lists**, even with one file. This is the current multi-sample-support API.
- `guide_barcode_*`, `guide_umi_*`, `sample_barcode_*` — prefix distinguishes a guide's library-encoded barcode/UMI from a per-read (single-cell) sample barcode.
- `is_<comp>_r1=True` extracts from R1 body; `is_<comp>_header=True` extracts from the R1 FASTQ header. If both are `False` / `None` and `fastq_r2_fns` is provided, the component is extracted from R2.

### Slim vs full output

By default the returned object holds the count Series + QC summary + input config — a lean object that pickles in ~150 KB on typical runs.

If you need **allele/mutation post-processing** (`get_matchset_alleleseries`, `get_mutation_profile`, `helper_get_observed_values_given_whitelist_value`), pass `retain_inference_results=True`. The result then also carries the full per-observation inference dict (`observed_guide_reporter_umi_counts_inferred`), which can be several GB on 45 M-read runs.

If you call a post-processing function on a slim result you get a clear error:

```
ValueError: get_matchset_alleleseries requires `observed_guide_reporter_umi_counts_inferred`
but the result object was built with `retain_inference_results=False` (the default).
Re-run the mapping call with `retain_inference_results=True` to enable
allele / mutation post-processing.
```

### Example -- full triplet with UMI in header

```python
import crispr_ambiguous_mapping as cam
import pandas as pd

whitelist_guide_reporter_df = pd.read_table("guide_library.tsv")

result = cam.mapping.get_whitelist_reporter_counts_from_fastq(
    whitelist_guide_reporter_df=whitelist_guide_reporter_df,
    fastq_r1_fns=["sample_R1.fastq.gz"],
    fastq_r2_fns=["sample_R2.fastq.gz"],

    # Protospacer: first 20 bp of R1
    protospacer_start_position=0, protospacer_length=20,
    is_protospacer_r1=True, revcomp_protospacer=False,

    # Surrogate: first 32 bp of R2 (reverse-complemented)
    surrogate_start_position=0, surrogate_length=32,
    is_surrogate_r1=False, revcomp_surrogate=True,

    # Guide barcode: parsed from R1 header via regex
    guide_barcode_pattern_regex=r"_([^_ ]+)[\s+]",
    is_guide_barcode_header=True, revcomp_guide_barcode=True,

    # UMI: parsed from R1 header via regex
    guide_umi_pattern_regex=r":([^+:]{8})(.{2})\+",
    is_guide_umi_header=True, revcomp_guide_umi=False,

    # Thresholds
    protospacer_hamming_threshold_strict=7,
    surrogate_hamming_threshold_strict=10,
    guide_barcode_hamming_threshold_strict=2,

    cores=8,

    # If you want to run allele / mutation post-processing on this result,
    # uncomment the next line. Default is False (slim result).
    # retain_inference_results=True,
)
```

### Accessing counts

The main output lives at:

```python
result.all_match_set_whitelist_reporter_counter_series_results
```

which has one attribute per match tier — `protospacer_match`, `protospacer_match_surrogate_match`, `protospacer_match_barcode_match`, `protospacer_match_surrogate_match_barcode_match`, and two mismatch tiers — each with nine `pd.Series` counters (3 ambiguity strategies × 3 UMI modes).

```python
# Example: UMI-collapsed, ambiguous-accepted full-triplet counts
series = (
    result.all_match_set_whitelist_reporter_counter_series_results
          .protospacer_match_surrogate_match_barcode_match
          .ambiguous_accepted_umi_collapsed_counterseries
)
series.head()
```

QC summary:

```python
result.quality_control_result.protospacer_match.num_non_error_umi_noncollapsed_counts
result.quality_control_result.protospacer_match.num_total_umi_noncollapsed_counts
```

### Post-processing (allele + mutation profiles)

When `retain_inference_results=True`, you can further analyze per-allele observations:

```python
match_set = cam.processing.get_matchset_alleleseries(
    result.observed_guide_reporter_umi_counts_inferred,
    "protospacer_match_surrogate_match_barcode_match",
    contains_guide_surrogate=result.count_input.contains_guide_surrogate,
    contains_guide_barcode=result.count_input.contains_guide_barcode,
    contains_guide_umi=result.count_input.contains_guide_umi,
)

mutations = cam.processing.get_mutation_profile(
    match_set,
    whitelist_reporter_df=result.count_input.whitelist_guide_reporter_df,
    contains_guide_surrogate=result.count_input.contains_guide_surrogate,
    contains_guide_barcode=result.count_input.contains_guide_barcode,
)

linked = cam.processing.tally_linked_mutation_count_per_sequence(
    mutations,
    contains_guide_surrogate=result.count_input.contains_guide_surrogate,
    contains_guide_barcode=result.count_input.contains_guide_barcode,
    count_attribute_name="ambiguous_accepted_umi_noncollapsed_mutations",
)

cam.visualization.plot_mutation_count_histogram(
    linked.protospacer_total_mutation_counter,
    filename="protospacer_mut_hist.png",
)
```

### Saving + reloading

Standard Python pickling works. With the slim default (`retain_inference_results=False`), pickle sizes are much smaller:

```python
import pickle

with open("result.pkl", "wb") as f:
    pickle.dump(result, f, protocol=pickle.HIGHEST_PROTOCOL)
```

Intermediate save utilities (e.g. `cam.utility.save_or_load_pickle`) remain available.

---

## Command-line interface (v0.2.0)

The package registers a `crispr-correct` console script with two subcommands. All flags mirror the Python `ParsingConfig` fields 1:1 (field names with `_` → `-`) — no config file, no YAML.

```bash
# Map
crispr-correct map \
    --r1 R1.fq.gz \
    --r2 R2.fq.gz \
    --library library.tsv \
    --out result.pickle \
    --protospacer-start-position 0 --protospacer-length 20 \
    --is-protospacer-r1 --no-revcomp-protospacer \
    --protospacer-hamming-threshold-strict 7 \
    --surrogate-start-position 0 --surrogate-length 32 \
    --no-is-surrogate-r1 --revcomp-surrogate \
    --surrogate-hamming-threshold-strict 10 \
    --guide-barcode-pattern-regex '_([^_ ]+)[\s+]' \
    --is-guide-barcode-header --revcomp-guide-barcode \
    --guide-barcode-hamming-threshold-strict 2 \
    --retain-inference-results \
    --cores 4

# Emit one tier's count Series as TSV
crispr-correct count \
    --in result.pickle \
    --out counts.tsv \
    --tier protospacer_match_surrogate_match_barcode_match \
    --strategy ambiguous_accepted_umi_noncollapsed_counterseries
```

Repeat `--r1` / `--r2` for multi-file input. Boolean flags use `--flag/--no-flag` convention. Run `crispr-correct map --help` for the full flag list.

### Save/load — parquet + JSON (cross-language durable)

```bash
# Convert a pickle into a parquet directory (portable across Python/R/Julia)
crispr-correct save --in result.pickle --out-dir result/
# Inspect in pandas:
#   pd.read_parquet("result/counts_protospacer_match_surrogate_match_barcode_match.parquet")

# Reconstruct a pickle from the directory
crispr-correct load --in-dir result/ --out result.pickle
```

Save/load via Python:

```python
import crispr_ambiguous_mapping as cam
cam.save(result, "result/")      # writes parquet + manifest.json + qc.json + count_input.json
result2 = cam.load("result/")    # reconstructs the result (without the inference dict)
```

The per-observation inference dict (`observed_guide_reporter_umi_counts_inferred`) is not round-tripped through parquet — pickle it if you need it.

### Post-processing — `alleles` subcommand

```bash
crispr-correct alleles \
    --in result.pickle \
    --tier protospacer_match_surrogate_match_barcode_match \
    --ambiguity accepted --umi-strategy noncollapsed \
    --out alleles.parquet
```

Requires the source pickle to have been produced with `--retain-inference-results`; otherwise emits a clear error pointing at the flag.

---

## Testing

A GitHub Actions workflow (`.github/workflows/ci.yml`) runs the smoke tests plus the 135-mode simulation regression on every push/PR (fast subset on push, full matrix on PR), against checked-in `tests/fixtures/` so no external data is needed.

This repository ships with a test suite under `../tests/` (one directory up from the package). Three layers of coverage:

- **`tests/test_sccrispr_cell_barcode.py`** — pytest regression against a real scCRISPR FASTQ pair with an auto-baselined golden pickle. Runs in ~75 s.
- **`tests/simulation/`** — ground-truth simulated data where every read's source guide, edits, UMI, and recombination state are known; compares all 135 combinations of (parsing mode × tier × ambiguity × UMI-strategy) to expected counts. Runs in ~90 s.
- **`tests/benchmarks/`** — real HbF sample data with `bench_results.jsonl` tracking wall time and peak RSS across optimization iterations.

Run everything:

```bash
cd CRISPR-Correct-Folder
ENV=/data/pinello/SHARED_SOFTWARE/envs/bfb12_envs/bb_crisprcorrect_LOCAL   # or your editable-install env
"$ENV/bin/pytest" tests/ -v
"$ENV/bin/jupyter" nbconvert --to notebook --execute --inplace tests/simulation/test_local.ipynb
```

---

## Supporting documentation

One level up from the package source, in `CRISPR-Correct-Folder/`:

- `ARCHITECTURE.md` — module map, pipeline stages, data models, Hamming / ambiguity algorithm.
- `USAGE.md` — recipes (protospacer-only / full-triplet+UMI / single-cell with sample_barcode), parameter cheat sheet, common pitfalls.
- `BRANCHES.md` — per-branch status (master, multi-sample-support, perf/counter-series-fix, perf/roadmap-phase1, …) and merge path.
- `EXAMPLES.md` — pointers to the in-tree production projects that use the package.
- `IMPROVEMENTS.md` — roadmap of tactical + architectural improvements across correctness, memory, performance, usability, DX.

