pYPKa_Z_PGItp

Plan for the construction of E. coli vector pYPKa_Z_PGItp

Step 1 PCR of the insert

PCR with primers pfw1000 & prv1000 and template PGI_template results in a 1013bp PCR product

Primers annealing on template:

      5AATTCAGTTTTCTGACTGA...CAAGATACCAGCCTAAAA3
                             |||||||||||||||||| tm 43.0 (dbd) 54.5
                            3GTTCTATGGTCGGATTTTAATTAAT5
5TTAAATAATTCAGTTTTCTGACTGA3
       ||||||||||||||||||| tm 43.6 (dbd) 53.8
      3TTAAGTCAAAAGACTGACT...GTTCTATGGTCGGATTTT5

Suggested PCR programs for Taq polymerase and for Polymerases with DNA binding domain:

Taq (rate 30 nt/s) 35 cycles             |1013bp
95.0°C    |95.0°C                 |      |SantaLucia 1998
|_________|_____          72.0°C  |72.0°C|SaltC 50mM
| 03min00s|30s  \         ________|______|
|         |      \ 51.0°C/ 0min30s| 5min |
|         |       \_____/         |      |
|         |         30s           |      |4-12°C

Step 2 Vector digestion and cloning

Clone the PCR product in pYPKa digested with ZraI resulting in pYPKa_Z_PGItp

Step 3 Diagnostic PCR confirmation

Confirm the structure of the pYPKa_Z_PGItp using primers 577, 342 and pfw1000 in a multiplex PCR reaction.

Expected PCR products sizes from 577, 342 and pfw1000 (bp):

pYPKa with insert in correct orientation: 1947, 1779
pYPKa with insert in reverse orientation: 1947, 1181
Empty pYPKa clone : 934