Metadata-Version: 2.4
Name: simple_blast
Version: 0.7.4
Summary: A simple library for executing BLAST searches with ncbi-blast+
Author-email: Andrew Tapia <andrew.tapia@uky.edu>
License-Expression: MIT
Project-URL: Homepage, https://github.com/actapia/simple_blast
Project-URL: Bug Tracker, https://github.com/actapia/simple_blast
Requires-Python: >=3.11
Description-Content-Type: text/markdown
License-File: LICENSE
Requires-Dist: pandas>=1.5.3
Requires-Dist: dateparser>=1.2.0
Dynamic: license-file

# simple_blast

This is a library that provides a (decreasingly) basic wrapper around
ncbi-blast+.  Currently, the library supports searches with `blastn` only, but I
may expand the library to include wrappers for other BLAST executables if I need
them.

## Dependencies

* Pandas (>= 1.5.6)
* ncbi-blast+ (>= 2.12.0+)

### Optional

* Biopython (>= 1.84, for SAM parsing and support for searching with SeqRecord)
* [pyblast4_archive](https://github.com/actapia/pyblast4_archive/) (>= 0.0.7,
  for conversion to SAM format)
* pysam (>= 0.23.1, for conversion to SAM format)
  
## Basic usage

You can define a `blastn` search to be carried out using the `BlastnSearch`
class. `BlastnSearch`objects are constructed with two required
arguments&mdash;the subject sequence and the query sequence files, in that
order. For example, to set up a `blastn` search for sequences in `seqs1.fasta`
against those in `seqs2.fasta` using output format 12 (Seqalign), you could
construct a `BlastnSearch` object like this:

```python
from simple_blast import BlastnSearch

search = BlastnSearch(21, "seqs1.fasta", "seqs2.fasta")
```

The BLAST search is not carried out until you ask for the results by running the
`get_output()` function.

```python
results = search.get_output()
```

`blastn` can output binary data, so the `get_output()` function appropriately
returns `bytes`.

Often, it's convenient to use output format 6, a tabular representation of the
HSPs. For that purpose, you can use `TabularBlastnSearch`.

```python
from simple_blast import TabularBlastnSearch

search = TabularBlastnSearch("seqs1.fasta", "seqs2.fasta")
```

The `hits` property of the search returns a Pandas dataframe containing the HSPs
identified in the BLAST search.

```python
results = search.hits
```

The columns in the output may be configured by passing either the `out_columns`
or `additional_columns` arguments when constructing the
`TabularBlastnSearch`. The former argument overrides the set of output columns;
the latter argument is added to the list of default output columns.

### Sequences from memory

`simple_blast` can handle BLAST searches with sequences stored in memory (i.e.,
not in a file). It works with sequences stored as strings or in
[BioPython](https://biopython.org/) `SeqRecord` objects.

```python
from Bio.SeqRecord import SeqRecord, Seq
from simple_blast import TabularBlastnSearch

# Define some data.
subjects = [
    SeqRecord(
	    Seq(
		"AAGGCGTACGGGCCTTTCGCTTCCGAAAACTTCCTCTTAGGTCGCTGTTACTGGATGTCGAGTCAGCACA"
		"TGGGAAACTCCACGCATCGGCGGGATTTCACAACGCCTAGAACACCGGTAATGCGAGTATCCGTATCGGT"
		"AACAAATATCTTTGGGATACTACAGGAATATCCGTAGGAGTTCGCCGCGATTAGGTGCCTCGATGATATG"
		"CAGCTGTCACTGGAGATAACACACTATGCAGCAGTAATGGATGTTATTGCTACTAAGGTTCCCTGTCACC"
	    ),
		id="My Sequence 1"
	),
    SeqRecord(
	    Seq(
		"TTCATTGGTGGGCTTTCTGGTTCACGCCCATCTCAATGTACATTTTCCGTGACGTGATGATAATCATAAC"
		"TCGTTGGTAGTAATAGGGTAAGGGAATTTGGCAGGTAGTCGGGGCAAGACTGCCGTTACAAGCTAATCAT"
		"CTGCCAACTAACTTTAGCCGTAATTGGCACTAACAGTTAACCTTCGCGCGTTTCTCAGTGTAGAGTGAGA"
		"CTATGTGATTACTTTCAGCGCCCAGCGGTGGTAGGTAGTAAAAAGTGGCCACCGAACCGAATGCT"
	    ),
		id="My Sequence 2"
	)
]
queries = [
    SeqRecord(
        Seq("TGGGAAACTCCACGCATCGGCGGGATTTCACAACGCCTAGAACACCGGTAATGCGAGTATCCGT"),
        id="Query 1"
    )
]

with TabularBlastnSearch.from_sequences(queries, subjects) as search:
    results = search.hits
```

or, using a list of strings:

```python
from simple_blast import TabularBlastnSearch

# Define some data.
subjects = [
    (
        "AAGGCGTACGGGCCTTTCGCTTCCGAAAACTTCCTCTTAGGTCGCTGTTACTGGATGTCGAGTCAGCACA"
        "TGGGAAACTCCACGCATCGGCGGGATTTCACAACGCCTAGAACACCGGTAATGCGAGTATCCGTATCGGT"
        "AACAAATATCTTTGGGATACTACAGGAATATCCGTAGGAGTTCGCCGCGATTAGGTGCCTCGATGATATG"
        "CAGCTGTCACTGGAGATAACACACTATGCAGCAGTAATGGATGTTATTGCTACTAAGGTTCCCTGTCACC"
    ),
    (
        "TTCATTGGTGGGCTTTCTGGTTCACGCCCATCTCAATGTACATTTTCCGTGACGTGATGATAATCATAAC"
        "TCGTTGGTAGTAATAGGGTAAGGGAATTTGGCAGGTAGTCGGGGCAAGACTGCCGTTACAAGCTAATCAT"
        "CTGCCAACTAACTTTAGCCGTAATTGGCACTAACAGTTAACCTTCGCGCGTTTCTCAGTGTAGAGTGAGA"
        "CTATGTGATTACTTTCAGCGCCCAGCGGTGGTAGGTAGTAAAAAGTGGCCACCGAACCGAATGCT"
    )
]
queries = ["TGGGAAACTCCACGCATCGGCGGGATTTCACAACGCCTAGAACACCGGTAATGCGAGTATCCGT"]

with TabularBlastnSearch.from_sequences(queries, subjects as search:
    results = search.hits
```

When using a list of strings, sequences are automatically named `seq_i`, where
i is the position of the sequence in the list.

You can use `SeqRecords` together with lists of strings, and you can also use
in-memory sequences together with files by providing the `subject` or `query`
keyword arguments to `from_sequences`.

```python
TabularBlastnSearch.from_sequences(
    subject_seqs=["CATGAACTA"],
	query="seqs1.fasta"
)
```

Since using a context manager is slightly cumbersome, you can also use the
`blastn_from_sequences` convenience function to get the hits for a search.

```python
from simple_blast import blastn_from_sequences

# Define some data.
subjects = [
    (
        "AAGGCGTACGGGCCTTTCGCTTCCGAAAACTTCCTCTTAGGTCGCTGTTACTGGATGTCGAGTCAGCACA"
        "TGGGAAACTCCACGCATCGGCGGGATTTCACAACGCCTAGAACACCGGTAATGCGAGTATCCGTATCGGT"
        "AACAAATATCTTTGGGATACTACAGGAATATCCGTAGGAGTTCGCCGCGATTAGGTGCCTCGATGATATG"
        "CAGCTGTCACTGGAGATAACACACTATGCAGCAGTAATGGATGTTATTGCTACTAAGGTTCCCTGTCACC"
    ),
    (
        "TTCATTGGTGGGCTTTCTGGTTCACGCCCATCTCAATGTACATTTTCCGTGACGTGATGATAATCATAAC"
        "TCGTTGGTAGTAATAGGGTAAGGGAATTTGGCAGGTAGTCGGGGCAAGACTGCCGTTACAAGCTAATCAT"
        "CTGCCAACTAACTTTAGCCGTAATTGGCACTAACAGTTAACCTTCGCGCGTTTCTCAGTGTAGAGTGAGA"
        "CTATGTGATTACTTTCAGCGCCCAGCGGTGGTAGGTAGTAAAAAGTGGCCACCGAACCGAATGCT"
    )
]
queries = ["TGGGAAACTCCACGCATCGGCGGGATTTCACAACGCCTAGAACACCGGTAATGCGAGTATCCGT"]

results = blastn_from_sequences(queries, subjects)
```

**Note:** Searching from in-memory sequences is implemented using Unix FIFOs, so
this feature currently will not work on Windows.

## DB caches

When the same sequence file is used as a subject in multiple searches, it can be
efficient to build a BLAST database up front. The `BlastDBCache` class can be
used to handle this mostly automatically. To make a `BlastDBCache`, you need
to specify the location of the on the file system.

```python
from simple_blast import BlastDBCache

cache = BlastDBCache("cache_dir")
```

To add a file to the cache, use the `makedb` method.

```python
cache.makedb("seqs2.fasta")
```

When constructing a `BlastnSearch` object, give it the `BlastDBCache` as the
`db_cache` parameter to make the `BlastnSearch` object use the cache for
searches.

```python
search = BlastnSearch(12, "seqs1.fasta", "seqs2.fasta", db_cache=cache)
```

Now `search` will use the database we created for `seqs2.fasta`.

## Explicit database searches

Rather than searching against a FASTA file or a database created implicitly with
BlastDBCache, you can also explicitly specify a database to query with the `db`
keyword argument.

```python
search = BlastnSearch(12, "seqs1.fasta", db="mydb")
```

## Remote searches

You can query the NCBI databases remotely using the `remote` parameter.

```python
search = BlastnSearch(12, "seqs1.fasta", db="nr", remote=True)
```

## Format conversions

It's sometimes useful to convert between different BLAST output
formats. ncbi-blast+ comes with a utility, `blast_formatter`, that can convert
output in the "Blast4 Archive" format (ASN.1, output format 11) to any other
BLAST format.

### Using `blast_formatter` with `simple_blast.convert`

You can use `blast_formatter` directly with the `simple_blast.convert`
module. For example,

```python
from simple_blast.convert import blast_format_file

# Convert to output format 11.
blast_format_file(12, "my_blast_results.asn1", "my_blast_results.json")
```

If you don't specify the output file, you can get the output as bytes.

```python
seqalign_bytes = blast_format_file(12, "my_blast_results.asn1")
```

You can also use the similar `blast_format_bytes` to provide bytes as input.

### Using `MultiformatBlastnSearch`

You can create a search with output format 11 using the
`MultiformatBlastnSearch` class.

```python
from simple_blast.multiformat import MultiformatBlastnSearch

search = MultiformatBlastnSearch("seqs1.fasta", "seqs2.fasta")
```

You can convert the output to another format using the `to` method.

```python
seqalign_bytes = search.to(12)
```

For output formats with an associated subclass of `BlastnSearch`, you can also
convert directly to that subclass with `to_search`..

```python
tabular_search = search.to_search(6)
results = tabular_search.hits # A Pandas DataFrame
```
