Metadata-Version: 2.4
Name: dynordg
Version: 0.3.6
Summary: Simulate and render the flux of Ribosomes through Ribosomal Phase Space
Author-email: "Kyle A. Meiklejohn" <kyle.meiklejohn314@gmail.com>
License-Expression: MIT
Project-URL: Homepage, https://github.com/k-meiklejohn/dynordg
Project-URL: Issues, https://github.com/k-meiklejohn/dynordg/issues
Keywords: translation,ribosome decision graph,RDG,simulation,graph
Classifier: Programming Language :: Python
Classifier: Programming Language :: Python :: 3
Classifier: Operating System :: OS Independent
Requires-Python: >=3.12
Description-Content-Type: text/markdown
License-File: LICENSE
Requires-Dist: biopython>=1.86
Requires-Dist: levenshtein>=0.27.3
Requires-Dist: matplotlib>=3.10.6
Requires-Dist: networkx>=3.5
Dynamic: license-file

# DYNORDG

Dynamic Ribosome Decision Graphs (RDGs) for simulating and visualizing ribosome flux along transcripts.

## Overview

A Ribosome Decision Graph (RDG) models the possible paths a ribosome can take along an mRNA transcript.

**Dynamic RDGs** extend this by:
- Representing ribosome flux using edge thickness
- Implicitly encoding overlapping translons via flow rather than explicit separation
- Modeling ribosomal phase states based on downstream potential

This package provides tools to:
- Build RDGs from transcript sequences, or from user defined phase transistions
- Simulate ribosome movement
- Render dynamic flux graphs

## Installation

```bash
pip install dynordg
```

## Quick Start

```python
from dynordg import Transcript, RiboGraphFlux, RiboGraphVis

# Create transcript
t = Transcript("AUGGCCAUGGCGCCCAGAACUGGGUAA")

# Automatically detect start/stop events
t.auto_stop_starts()

# Build flux graph
graph = RiboGraphFlux(t.transition_map())

# Create render object
plot = RiboGraphVis(graph)

# Render
plot.show()
```

## Example Output

Below is example dynamic RDG (if not a realistic one):

![Example RDG](docs/example.png)




