Metadata-Version: 2.4
Name: caddsv
Version: 2.0.2
Summary: CADD-SV Structural Variant scoring Workflow
Author-email: Orazio Catona <orazio.catona@uni-luebeck.de>, Martin Kircher <martin.kircher@uni-luebeck.de>
License-Expression: MIT
Project-URL: Homepage, https://cadd-sv.bihealth.org
Project-URL: Repository, https://github.com/kircherlab/CADD-SV
Project-URL: Issues, https://github.com/kircherlab/CADD-SV/issues
Keywords: SV,Variant Effects,Scoring,Annotation,Prioritization
Classifier: Programming Language :: Python :: 3
Classifier: Operating System :: POSIX :: Linux
Classifier: Operating System :: Unix
Classifier: Topic :: Scientific/Engineering :: Bio-Informatics
Requires-Python: >=3.9
Description-Content-Type: text/markdown
License-File: LICENSE
Requires-Dist: typer>=0.9
Requires-Dist: huggingface_hub>=0.24
Requires-Dist: snakemake<9,>=7.31.0
Requires-Dist: pulp==2.7
Dynamic: license-file

# CADD-SV
[![GitHub release](https://img.shields.io/github/v/release/kircherlab/CADD-SV)](https://github.com/kircherlab/CADD-SV/releases/latest)
[![PyPI version](https://img.shields.io/pypi/v/caddsv.svg)](https://pypi.org/project/caddsv/)
[![Bioconda version](https://img.shields.io/conda/vn/bioconda/caddsv.svg?style=flat)](https://bioconda.github.io/recipes/caddsv/README.html)
[![License: MIT](https://img.shields.io/badge/License-MIT-yellow.svg)](https://github.com/kircherlab/CADD-SV/blob/main/LICENSE)

CADD-SV is a command-line tool for scoring structural variants (SVs). The
`caddsv` command wraps the packaged Snakemake workflow, prepares input files,
runs scoring, and copies final score tables into a stable output directory.

## Quick Start

Install from a source checkout:

```bash
conda create -n caddsv python=3.12 pip
conda activate caddsv
git clone https://github.com/kircherlab/CADD-SV.git
cd CADD-SV
pip install .
```

Alternatively, install CADD-SV from Bioconda:

```bash
conda install -c bioconda caddsv
```
Installation through PyPI is also available:

```bash
pip install caddsv
```
Conda is the default workflow backend: running `caddsv run` without container
options lets Snakemake create and reuse the required Conda environments.

Check the installed CADD-SV version with:

```bash
caddsv --version
```

Download the annotation bundle:

```bash
caddsv get annotations --annotations-dir /data/caddsv/annotations
```

Score a BED file:

```bash
caddsv run examples/variants.bed \
  --annotations-dir /data/caddsv/annotations \
  --output-dir /data/caddsv/runs/variants \
  --threads 8
```

Final scores are copied to:

```text
/data/caddsv/runs/variants/scored/variants_score.tsv
```

To run SegmentNT-backed modes, download the model files once:

```bash
caddsv get segmentnt --annotations-dir /data/caddsv/annotations
```

You can also download annotations and SegmentNT together:

```bash
caddsv get annotations \
  --annotations-dir /data/caddsv/annotations \
  --with-segmentnt
```

## Default runtime: Conda

CADD-SV installs with `pip install .` from this repository or from Bioconda. The
package includes the CLI and workflow files. By default, full scoring also uses
Conda at runtime so Snakemake can create isolated environments for the workflow
rules.

Note that the runtime and prefetch defaults are different:

- `caddsv run` uses Conda by default.
- `caddsv get envs` downloads Apptainer/Singularity images by default for
  backward compatibility.
- Use `caddsv get envs --use-conda` when you want to create the Conda
  environments ahead of a normal, Conda-backed run.

By default, those environments are cached under:

```text
${XDG_CACHE_HOME:-$HOME/.cache}/caddsv/snakemake-conda/
```

Use `--conda-prefix` or `CADD_SV_CONDA_PREFIX` to place them on scratch or
shared storage:

```bash
# Prefetch the Conda environments. Without --use-conda, this command fetches
# Apptainer/Singularity images instead.
caddsv get envs --use-conda \
  --conda-prefix /scratch/$USER/caddsv-conda

# Reuse the prefetched Conda environments during scoring.
caddsv run sample.bed --conda-prefix /scratch/$USER/caddsv-conda
```

The `get envs` command asks Snakemake to create all workflow Conda
environments without requiring an input file or running workflow jobs. A later
`caddsv run` reuses them when given the same prefix. Add
`--coordinate-based-only` to omit the NT environment. Conda must be available
on `PATH` while the environments are created.

For a container or another pre-provisioned environment, disable Snakemake's
per-rule conda environments:

```bash
caddsv run sample.bed --no-use-conda
```

In this mode, CADD-SV does not create a conda cache and does not pass
`--use-conda` or `--conda-prefix` to Snakemake. Every executable and Python
package required by the selected workflow rules must already be available in
the parent environment. The files under `caddsv/workflow/envs/` describe those
rule dependencies.

## Optional: Apptainer/Singularity for pipelines

Conda is the recommended default for an interactive or single-machine CADD-SV
run. Use Apptainer or Singularity when CADD-SV is part of a scheduled pipeline,
when execution happens on multiple compute nodes, or when the pipeline platform
requires containers. Containerized runs use fixed versioned images instead of
creating Conda environments for the workflow rules.

Prefetch the images once into storage that is available to the pipeline jobs,
then use that same location for every run. This avoids concurrent first-time
image pulls when many jobs start together and makes each job reuse the prepared
images:

```bash
caddsv get envs \
  --apptainer-prefix /scratch/$USER/caddsv-singularity

caddsv run sample.bed \
  --use-apptainer \
  --apptainer-prefix /scratch/$USER/caddsv-singularity
```

Images are cached in `${XDG_CACHE_HOME:-$HOME/.cache}/caddsv/snakemake-singularity`
by default. In its default image mode, `caddsv get envs` downloads all four
images before execution, which avoids simultaneous first-time pulls when
multiple runs start in parallel. For coordinate-only scoring,
`--coordinate-based-only` omits the unused NT image. Existing images are reused
unless `--force-envs` is supplied.

Apptainer or Singularity must be installed on every execution host. The
`--use-apptainer` and `--use-singularity` flags are equivalent; use the former
when that is the runtime installed on the system. For GPU-enabled SegmentNT
execution, pass the runtime flag explicitly:

```bash
caddsv run sample.bed --use-apptainer --apptainer-args=--nv
```

Override the image URIs, including with local SIF paths on an air-gapped
cluster, through the `containers` mapping in a config file. The package includes
the Dockerfile and environment definitions used to build the images; image
binaries are published separately.

## Data

### Annotations

The annotation bundle is downloaded from:

```text
https://kircherlab.bihealth.org/download/CADD-SV/v2.0/dependencies.tar.gz
```

The default destination is `./annotations`. For reproducible runs, use an
explicit path and pass the same path to `caddsv run`:

```bash
caddsv get annotations --annotations-dir /data/caddsv/annotations
caddsv run sample.bed --annotations-dir /data/caddsv/annotations
```

### SegmentNT

`--seqresolved` and `--seqonly` require SegmentNT model files. The default local
location is:

```text
<annotations-dir>/segment_nt/
```

If the model lives somewhere else, set `SEGMENTNT_MODEL`:

```bash
SEGMENTNT_MODEL=/models/segment_nt \
caddsv run sample.bed --seqresolved --annotations-dir /data/caddsv/annotations
```

For offline runs, point to a local model directory and set:

```bash
HF_HUB_OFFLINE=1
TRANSFORMERS_OFFLINE=1
SEGMENTNT_LOCAL_FILES_ONLY=1
```

SegmentNT is downloaded from `InstaDeepAI/segment_nt` on Hugging Face and is
licensed separately under CC BY-NC-SA 4.0.

## Recommended Layout

Use explicit annotation and output paths when running from different working
directories:

```text
/data/caddsv/
  annotations/
    CADD/
    ucsc/
    segment_nt/
  runs/
    sample/
```

If paths are omitted, CADD-SV uses `./annotations` and `./caddsv_results`
relative to the current working directory.

## Running CADD-SV

### Coordinate-Based Scoring

```bash
caddsv run examples/variants.bed \
  --annotations-dir /data/caddsv/annotations \
  --output-dir sample_results
```

Multiple BED files can be scored in one invocation:

```bash
caddsv run sample1.bed sample2.bed \
  --annotations-dir /data/caddsv/annotations \
  --output-dir batch_results
```

### Sequence-Resolved Scoring

`--seqresolved` adds SegmentNT-derived features to coordinate-based scoring:

```bash
caddsv run sample.bed \
  --seqresolved \
  --annotations-dir /data/caddsv/annotations \
  --output-dir sample_seqresolved
```

This mode needs both the coordinate annotation bundle and SegmentNT model files.
GPU execution is recommended for normal use; CPU execution is mainly practical
for very small tests.

### Sequence-Only Scoring

`--seqonly` scores REF/ALT sequence pairs instead of genomic coordinates:

```bash
caddsv run examples/sequences.tsv \
  --seqonly \
  --annotations-dir /data/caddsv/annotations \
  --output-dir seqonly_results
```

Sequence-only mode needs SegmentNT. It does not use coordinate annotation
tracks, but `--annotations-dir` is still useful when SegmentNT is stored under
`<annotations-dir>/segment_nt`.

### Reusing Prepared Inputs

When a BED file is passed to `caddsv run`, CADD-SV writes a normalized copy to:

```text
<output-dir>/input/id_<dataset>.bed
```

You can later rerun by dataset name:

```bash
caddsv run sample \
  --output-dir caddsv_results \
  --annotations-dir /data/caddsv/annotations
```

For `--seqonly`, the prepared input is `input/id_<dataset>.tsv`.

## Inputs

### BED

Coordinate-based modes use uncompressed `.bed` files with at least four
tab-separated columns:

```text
chrom    start    end    type    [sequence]
```

BED uses a 0-based start and 1-based end coordinate; interval length is
`end - start`. Supported SV types are `DEL`, `DUP`, `INS`, and `INV`. SVs should
be at least 50 bp; for `INS`, this means providing an inserted sequence of at
least 50 bp in the optional fifth column when running `--seqresolved`.

The repository includes a minimal BED example at `examples/variants.bed`:

```text
chr1    999999     1000049    DEL
chr2    2999999    3000000    INS    ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
```

Before running Snakemake, the CLI adds missing `chr` prefixes, keeps standard
chromosomes (`chr1` through `chr22`, `chrX`, `chrY`), keeps supported SV types,
skips short rows, sorts by chromosome and start, and writes the normalized file
under `<output-dir>/input/`.

Compressed `.bed.gz` files are not auto-preprocessed; decompress them first or
prepare the normalized input manually.

### Sequence-Only TSV

`--seqonly` requires `.tsv` input with positional columns. Each row must include
`REF` and `ALT`; `TYPE` and `ID` are optional. Do not include a header row unless
it is an actual sequence record.

```text
REF    ALT    TYPE    ID
```

| Column | Required | Default |
| --- | --- | --- |
| `REF` | Yes | None |
| `ALT` | Yes | None |
| `TYPE` | No | `SV` |
| `ID` | No | Blank; omitted from final output when absent |

Sequence-only preprocessing uppercases sequences, requires matching 96 bp
flanks, shrinks long middle sequence, and normalizes `N` runs for SegmentNT
tokenization.

The repository includes a headerless sequence-only example with DEL and INS
records at `examples/sequences.tsv`.

## Outputs

For `sample.bed` and the default output directory:

```text
caddsv_results/
  input/id_sample.bed
  beds/sample/
  scored/sample_score.tsv
```

For `sequences.tsv --seqonly`:

```text
caddsv_results/
  input/id_sequences.tsv
  beds/sequences/
  scored/sequences_seqonly_score.tsv
```

The `scored/` directory is the stable user-facing output location. The `beds/`
directory contains Snakemake intermediates and native workflow outputs.

Main score columns:

| Mode | Main score columns |
| --- | --- |
| Coordinate scoring | `CADD-SV_PHRED`, `CADD-SV_score` |
| Sequence-resolved scoring | `CADD-SV_PHRED`, `CADD-SV_score`, `CADD-SV-SR_PHRED`, `CADD-SV-SR_score` |
| Sequence-only scoring | `CADD-SV_seqonly_PHRED`, `CADD-SV_seqonly_score` |

The output also keeps annotation and model feature columns for downstream
inspection.

Only files in `scored/` are formatted for final presentation. Coordinate-based
files use `#chr` as their first header field, and every raw `*_score` value is
written with exactly four decimal places. PHRED columns and the workflow-native
files under `beds/` retain their original precision.

## Options

### Global

```bash
caddsv --version
```

Print the version of the installed CADD-SV distribution.

### `caddsv get`

```bash
caddsv get annotations [--annotations-dir PATH] [--with-segmentnt] [--force-segmentnt]
caddsv get segmentnt   [--annotations-dir PATH] [--force-segmentnt] [--segmentnt-repo REPO]
caddsv get envs --use-conda [--conda-prefix PATH] [--coordinate-based-only]
caddsv get envs [--apptainer-prefix PATH] [--coordinate-based-only] [--force-envs]
```

| Option | Meaning |
| --- | --- |
| `--annotations-dir PATH` | Annotation directory. Default: `./annotations`. |
| `--with-segmentnt` | Also download SegmentNT into `<annotations-dir>/segment_nt`. |
| `--force-segmentnt` | Replace an existing local SegmentNT directory. |
| `--segmentnt-repo REPO` | Hugging Face SegmentNT repository. Default: `InstaDeepAI/segment_nt`. |
| `--use-conda` | Create the workflow Conda environments instead of downloading environment images. |
| `--conda-prefix PATH` | Snakemake Conda environment directory; requires `--use-conda`. |
| `--apptainer-prefix PATH` / `--singularity-prefix PATH` | Environment image directory; uses the same default and overrides as `caddsv run`. |
| `--coordinate-based-only` | Prefetch preprocessing, SV, and training environments without NT. |
| `--force-envs` | Re-download environment images already present; image backend only. |

### `caddsv run`

```bash
caddsv run INPUT [INPUT ...] [OPTIONS]
```

| Option | Meaning |
| --- | --- |
| `--threads`, `-j` | Maximum Snakemake jobs. Default: `4`. |
| `--annotations-dir PATH` | Annotation directory. Default: `./annotations`. |
| `--output-dir`, `-o PATH` | Results directory. Default: `./caddsv_results`. |
| `--use-conda` / `--no-use-conda` | Enable or disable Snakemake conda environments. Enabled by default. |
| `--conda-prefix PATH` | Snakemake conda environment directory. |
| `--use-singularity` / `--use-apptainer` | Run rules in their versioned OCI/SIF containers. |
| `--singularity-prefix PATH` / `--apptainer-prefix PATH` | Singularity/Apptainer image cache directory. |
| `--singularity-args TEXT` / `--apptainer-args TEXT` | Extra runtime arguments, such as `--nv` for GPUs. |
| `--snakemake-args TEXT` | Extra Snakemake arguments; appended last and may override CADD-SV settings. |
| `--config`, `-c PATH` | Alternate Snakemake YAML configuration. |
| `--seqresolved` | Add SegmentNT-derived features to coordinate-based scoring. |
| `--seqonly` | Run sequence-only scoring from REF/ALT TSV input. |
| `--force` | Pass `--forceall` to Snakemake. |
| `--unlock` | Unlock a locked Snakemake output directory. |
| `--dry-run` | Display the Snakemake execution plan without running jobs or publishing scores. |
| `--check-time` | Write a small resource summary log. |

## Runtime Notes

`caddsv run` exposes the commonly used workflow options directly. Additional
Snakemake options can be supplied as one quoted string with `--snakemake-args`:

```bash
caddsv run sample.bed \
  --snakemake-args="--keep-going --latency-wait 60"

caddsv run sample.bed \
  --snakemake-args="--profile profiles/slurm --printshellcmds"
```

The value is split using shell-style quoting, so options containing spaces can
be nested inside the outer quotes, for example
`--snakemake-args='--report "reports/CADD SV.html"'`. The arguments are passed
directly to Snakemake without being executed by a shell.

Forwarded arguments are appended after the command generated by CADD-SV. This
allows advanced users to override some generated options, but Snakemake does
not handle every repeated option in the same way. CADD-SV warns when forwarded
arguments overlap its managed settings, change the selected DAG or output
handling, select a deployment backend, or request destructive cleanup. The
arguments are still forwarded so expert use cases remain possible.

Additional Snakemake `--config KEY=VALUE` entries are merged into CADD-SV's
generated config, with the forwarded values applied last. Prefer CADD-SV's
direct options such as `--threads`, `--config`, `--use-apptainer`, and
`--conda-prefix` where equivalents exist. `--snakemake-args` is available only
on `caddsv run`.

Use CADD-SV's first-class dry-run option to inspect the execution plan safely:

```bash
caddsv run sample.bed --dry-run
```

Dry runs stage the input and create the results directory needed to construct
the DAG, but they do not execute Snakemake jobs or publish score files. Known
Snakemake inspection and early-exit modes passed through `--snakemake-args`
also skip CADD-SV score post-processing so stale workflow files are not
republished as new results.

- First runs are slower because Snakemake creates or pulls software environments;
  prefetch with `caddsv get envs --use-conda` for Conda runs or
  `caddsv get envs` for containerized runs.
- In containerized runs, use `--no-use-conda` for a prebuilt parent environment
  or `--use-apptainer` for per-rule images.
- Use the same `--output-dir` to resume or reuse work from an interrupted run.
- Use a new `--output-dir` when comparing inputs with the same filename stem.
- `--threads` controls Snakemake cores, but some steps are I/O-bound.
- SegmentNT is much faster on GPU than CPU.
- Keep annotations and outputs on fast local storage when possible.

To remove cached Snakemake conda environments:

```bash
rm -rf "${XDG_CACHE_HOME:-$HOME/.cache}/caddsv/snakemake-conda"
```

To record a resource summary:

```bash
caddsv run sample.bed \
  --annotations-dir /data/caddsv/annotations \
  --check-time
```

This writes `caddsv_run_<YYYYMMDD_HHMMSS>.log` with the Snakemake command,
return code, wall time, CPU time, CPU utilization, and maximum RSS.

## Configuration

Most users should prefer CLI flags over editing config files. Use `--config`
only when you need an alternate Snakemake YAML configuration:

```bash
caddsv run sample.bed --config custom.yml
```

The packaged default config is `caddsv/config.yml`.

## How to cite CADD-SV

If you use CADD-SV v2.0, please cite the following preprint:

> Catona O, Kircher M
>
> *Coordinate- and Sequence-Based Features for a new Combined
> Annotation-Dependent Depletion Framework of Structural Variants
> (CADD-SV v2.0)*
>
> bioRxiv. 2026.07.08.736040. Posted July 10, 2026.
>
> DOI: [10.64898/2026.07.08.736040](https://doi.org/10.64898/2026.07.08.736040).
>
> This article is a preprint and has not been certified by peer review.

CADD-SV v1.x has been published as a research article in *Genome Research*;
please cite the following paper:

> Philip Kleinert P, Kircher M
>
> *A framework to score the effects of structural variants in health and disease*
>
> *Genome Research*. 2022 Apr;32(4):766-777.
>
> DOI: [10.1101/gr.275995.121](https://doi.org/10.1101/gr.275995.121). Epub 2022 Feb 23.
>
> PubMed PMID: [35197310](http://www.ncbi.nlm.nih.gov/pubmed/35197310).

If you want to reference the concept behind CADD, please cite:

> Kircher M, Witten DM, Jain P, O'Roak BJ, Cooper GM, Shendure J.
>
> *A general framework for estimating the relative pathogenicity of human genetic variants.*
>
> *Nature Genetics*. 2014 Feb 2.
>
> DOI: [10.1038/ng.2892](https://doi.org/10.1038/ng.2892).
>
> PubMed PMID: [24487276](http://www.ncbi.nlm.nih.gov/pubmed/24487276).

## Troubleshooting

### Missing Annotations

Download annotations and run with the same path:

```bash
caddsv get annotations --annotations-dir /data/caddsv/annotations
caddsv run sample.bed --annotations-dir /data/caddsv/annotations
```

### SegmentNT Downloads at Runtime

Download SegmentNT locally, then rerun with the same annotation directory:

```bash
caddsv get segmentnt --annotations-dir /data/caddsv/annotations
caddsv run sample.bed --seqresolved --annotations-dir /data/caddsv/annotations
```

If the model is outside the annotation directory, set `SEGMENTNT_MODEL`.

### Locked Snakemake Directory

```bash
caddsv run sample.bed --unlock --output-dir caddsv_results
```

Then rerun the original command.

### Existing Input Prompt

If `<output-dir>/input/id_<dataset>.bed` or `.tsv` exists with different
content, CADD-SV asks before overwriting. Use a new `--output-dir` to avoid
prompts when comparing inputs with the same dataset name.

### Slow First Run

Common causes are conda environment creation, SegmentNT or PyTorch dependency
setup, CPU-based SegmentNT execution, or annotation files on slow storage.

## Minimal Smoke Test

With annotations already downloaded, run the included BED example:

```bash
caddsv run examples/variants.bed \
  --annotations-dir /data/caddsv/annotations \
  --output-dir test_run \
  --threads 1
```

Expected output:

```text
test_run/scored/variants_score.tsv
```

For `--seqresolved`, download SegmentNT first and run:

```bash
caddsv run examples/variants.bed \
  --seqresolved \
  --annotations-dir /data/caddsv/annotations \
  --output-dir test_seqresolved \
  --threads 1
```

Expected output:

```text
test_seqresolved/scored/variants_score.tsv
```

For `--seqonly`, download SegmentNT first and run:

```bash
caddsv run examples/sequences.tsv \
  --seqonly \
  --annotations-dir /data/caddsv/annotations \
  --output-dir test_seqonly \
  --threads 1
```

Expected output:

```text
test_seqonly/scored/sequences_seqonly_score.tsv
```
