Metadata-Version: 2.4
Name: samplesheet-parser
Version: 0.1.4
Summary: Format-agnostic parser for Illumina SampleSheet.csv files — supports IEM V1 and BCLConvert V2
Project-URL: Homepage, https://github.com/chaitanyakasaraneni/samplesheet-parser
Project-URL: Documentation, https://illumina-samplesheet.readthedocs.io
Project-URL: Repository, https://github.com/chaitanyakasaraneni/samplesheet-parser
Project-URL: Issues, https://github.com/chaitanyakasaraneni/samplesheet-parser/issues
Author-email: Chaitanya Kasaraneni <kc.kasaraneni@gmail.com>
License:                                  Apache License
                                   Version 2.0, January 2004
                                http://www.apache.org/licenses/
        
        TERMS AND CONDITIONS FOR USE, REPRODUCTION, AND DISTRIBUTION
        
        Copyright 2026 Chaitanya Kasaraneni
        
        Licensed under the Apache License, Version 2.0 (the "License");
        you may not use this file except in compliance with the License.
        You may obtain a copy of the License at
        
            http://www.apache.org/licenses/LICENSE-2.0
        
        Unless required by applicable law or agreed to in writing, software
        distributed under the License is distributed on an "AS IS" BASIS,
        WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
        See the License for the specific language governing permissions and
        limitations under the License.
License-File: LICENSE
Keywords: bcl2fastq,bclconvert,bioinformatics,demultiplexing,genomics,illumina,ngs,samplesheet,sequencing
Classifier: Development Status :: 3 - Alpha
Classifier: Intended Audience :: Developers
Classifier: Intended Audience :: Science/Research
Classifier: License :: OSI Approved :: Apache Software License
Classifier: Programming Language :: Python :: 3
Classifier: Programming Language :: Python :: 3.10
Classifier: Programming Language :: Python :: 3.11
Classifier: Programming Language :: Python :: 3.12
Classifier: Topic :: Scientific/Engineering :: Bio-Informatics
Classifier: Typing :: Typed
Requires-Python: >=3.10
Requires-Dist: loguru>=0.7
Provides-Extra: dev
Requires-Dist: black>=24.0; extra == 'dev'
Requires-Dist: mypy>=1.8; extra == 'dev'
Requires-Dist: pytest-cov>=4.1; extra == 'dev'
Requires-Dist: pytest>=7.4; extra == 'dev'
Requires-Dist: ruff>=0.3; extra == 'dev'
Description-Content-Type: text/markdown

# samplesheet-parser

**Format-agnostic Python parser for Illumina `SampleSheet.csv` files.**

Supports IEM V1 (bcl2fastq / NovaSeq 6000 era) and BCLConvert V2 (NovaSeq X series) with automatic format detection, index validation, and `OverrideCycles` / UMI decoding — no format hints required from the caller.

[![PyPI version](https://img.shields.io/pypi/v/samplesheet-parser.svg)](https://pypi.org/project/samplesheet-parser/)
[![Python 3.10+](https://img.shields.io/badge/python-3.10+-blue.svg)](https://www.python.org/downloads/)
[![License: Apache 2.0](https://img.shields.io/badge/License-Apache_2.0-yellow.svg)](https://opensource.org/licenses/Apache-2.0)
[![Tests](https://github.com/chaitanyakasaraneni/samplesheet-parser/actions/workflows/ci.yml/badge.svg)](https://github.com/chaitanyakasaraneni/samplesheet-parser/actions)
[![codecov](https://codecov.io/gh/chaitanyakasaraneni/samplesheet-parser/branch/main/graph/badge.svg?token=CODECOV_TOKEN)](https://codecov.io/gh/chaitanyakasaraneni/samplesheet-parser)

---

## The problem

Labs running mixed instrument fleets — NovaSeq 6000 alongside NovaSeq X series — produce two structurally incompatible `SampleSheet.csv` formats:

| | IEM V1 | BCLConvert V2 |
|---|---|---|
| Discriminator | `IEMFileVersion` in `[Header]` | `FileFormatVersion` in `[Header]` |
| Data section | `[Data]` | `[BCLConvert_Data]` |
| Settings section | `[Settings]` | `[BCLConvert_Settings]` |
| Index columns | `index`, `index2` (lowercase) | `Index`, `Index2` (uppercase) |
| Read cycles | Bare integers | Key-value (`Read1Cycles,151`) |
| UMI encoding | Not supported | `OverrideCycles` string |
| Used with | bcl2fastq | BCLConvert ≥ 3.x |

Without a single parser, every pipeline component that reads a SampleSheet needs an `if v1 else v2` branch — or worse, the format is hardcoded and the wrong sheet is silently processed.

---

## Installation

```bash
pip install samplesheet-parser
```

Requires Python 3.10+. The only mandatory dependency is [`loguru`](https://github.com/Delgan/loguru).

---

## Quickstart

### Auto-detect format (recommended)

```python
from samplesheet_parser import SampleSheetFactory

factory = SampleSheetFactory()
sheet = factory.create_parser("SampleSheet.csv", parse=True)

print(factory.version)           # SampleSheetVersion.V1 or .V2
print(sheet.index_type())        # "dual", "single", or "none"
print(factory.get_umi_length())  # 0 if no UMI

for sample in sheet.samples():
    print(sample["sample_id"], sample["index"])
```

### Validate before demultiplexing

```python
from samplesheet_parser import SampleSheetFactory, SampleSheetValidator

sheet = SampleSheetFactory().create_parser("SampleSheet.csv", parse=True)
result = SampleSheetValidator().validate(sheet)

print(result.summary())
# PASS — 0 error(s), 1 warning(s)

for err in result.errors:
    print(err)
# [ERROR] DUPLICATE_INDEX: Index 'ATTACTCG+TATAGCCT' appears more than once in lane 1.
```

### UMI extraction (V2 only)

```python
from samplesheet_parser import SampleSheetV2

sheet = SampleSheetV2("SampleSheet.csv", parse=True)

# OverrideCycles: Y151;I10U9;I10;Y151 → 9 bp UMI in Index1
print(sheet.get_umi_length())        # 9
rs = sheet.get_read_structure()
print(rs.umi_location)               # "index2"
print(rs.read_structure)             # {"read1_template": 151, "index2_length": 10, "index2_umi": 9, ...}
```

### Use parsers directly

```python
from samplesheet_parser import SampleSheetV1, SampleSheetV2

# V1
v1 = SampleSheetV1("SampleSheet_v1.csv", parse=True)
print(v1.experiment_name)    # "240115_A01234_0042_AHJLG7DRXX"
print(v1.instrument_type)    # "NovaSeq 6000"
print(v1.adapter_read1)      # "AGATCGGAAGAGCACACGTCTGAACTCCAGTCA"
print(v1.adapter_read2)      # "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT"
print(v1.reverse_complement) # 0
print(v1.read_lengths)       # [151, 151]

# V2
v2 = SampleSheetV2("SampleSheet_v2.csv", parse=True)
print(v2.instrument_platform)  # "NovaSeqXSeries"
print(v2.software_version)     # "3.9.3"
```

---

## Format detection logic

The factory uses a three-step strategy — stopping as early as possible:

```
1. Scan [Header] for FileFormatVersion  → V2
                  or IEMFileVersion     → V1

2. If undetermined: scan full file for
   [BCLConvert_Settings] or
   [BCLConvert_Data]                    → V2

3. Default                              → V1
```

The file is read only once. No second `open()`, no `seek()`.

---

## OverrideCycles decoding

The V2 `OverrideCycles` string encodes the full read structure using single-letter type codes:

| Code | Meaning |
|---|---|
| `Y` | Template (sequenced) bases |
| `I` | Index bases |
| `U` | UMI bases |
| `N` | Masked / skipped bases |

Segment order: `Read1 ; Index1 ; Index2 ; Read2`

| OverrideCycles | UMI length | UMI location |
|---|---|---|
| `Y151;I10;I10;Y151` | 0 | — |
| `Y151;I10U9;I10;Y151` | 9 bp | Index1 |
| `U5Y146;I8;I8;U5Y146` | 5 bp | Read1 + Read2 |
| `Y76;I8;Y76` | 0 | — (single-index) |

---

## Validation checks

| Code | Level | Condition |
|---|---|---|
| `EMPTY_SAMPLES` | error | No samples found in data section |
| `INVALID_INDEX_CHARS` | error | Index contains non-ACGTN characters |
| `INDEX_TOO_LONG` | error | Index longer than 24 bp |
| `DUPLICATE_INDEX` | error | Two samples share an index in the same lane |
| `DUPLICATE_SAMPLE_ID` | error | Same `Sample_ID` appears twice in one lane |
| `INDEX_TOO_SHORT` | warning | Index shorter than 6 bp |
| `NO_ADAPTERS` | warning | No adapter sequences configured |
| `ADAPTER_MISMATCH` | warning | Adapter is not a standard Illumina sequence |

---

## API reference

### `SampleSheetFactory`

```python
factory = SampleSheetFactory()
sheet = factory.create_parser(path, *, clean=True, experiment_id=None, parse=None)
```

| Attribute / Method | Returns | Description |
|---|---|---|
| `.create_parser(path, ...)` | `SampleSheetV1 \| SampleSheetV2` | Auto-detect format and return parser |
| `.get_umi_length()` | `int` | UMI length from current parser |
| `.version` | `SampleSheetVersion` | Detected version after `create_parser()` |

### Shared interface — `SampleSheetV1` and `SampleSheetV2`

| Method / Attribute | Returns | Description |
|---|---|---|
| `.parse(do_clean=True)` | `None` | Parse all sections |
| `.samples()` | `list[dict]` | One record per unique sample |
| `.index_type()` | `str` | `"dual"`, `"single"`, or `"none"` |
| `.adapters` | `list[str]` | All configured adapter sequences |
| `.experiment_name` | `str \| None` | Run or experiment name |
| `.read_lengths` / `.reads` | `list[int]` / `dict` | Read cycle lengths |

### V1-specific

| Attribute | Type | Description |
|---|---|---|
| `.iem_version` | `str \| None` | e.g. `"5"` |
| `.instrument_type` | `str \| None` | e.g. `"NovaSeq 6000"`, `"MiSeq"` |
| `.application` | `str \| None` | e.g. `"FASTQ Only"` |
| `.assay` | `str \| None` | Library prep kit name |
| `.index_adapters` | `str \| None` | Illumina index set name |
| `.chemistry` | `str \| None` | `"Amplicon"` = dual index, `"Default"` = single/no index |
| `.adapter_read1` | `str` | Read 1 adapter (`Adapter` or `AdapterRead1` key) |
| `.adapter_read2` | `str` | Read 2 adapter (`AdapterRead2` key) |
| `.reverse_complement` | `int` | `0` = default, `1` = reverse-complement R2 (Nextera MP only) |
| `.flowcell_id` | `str \| None` | Parsed from experiment ID run folder name |

### V2-specific

| Method / Attribute | Returns | Description |
|---|---|---|
| `.get_umi_length()` | `int` | UMI length from `OverrideCycles` |
| `.get_read_structure()` | `ReadStructure` | Full decoded read structure |
| `.instrument_platform` | `str \| None` | e.g. `"NovaSeqXSeries"` |
| `.software_version` | `str \| None` | BCLConvert version string |
| `.custom_fields` | `dict[str, set[str]]` | Non-standard fields by section |

---

## Example sample sheets

The [`examples/sample_sheets/`](examples/sample_sheets/) directory contains ready-to-use reference sheets for every supported configuration:

| File | Format | Instrument | UMI | Use case |
|---|---|---|---|---|
| `v1_dual_index.csv` | V1 | NovaSeq 6000 | No | Standard WGS, multi-lane |
| `v1_single_index.csv` | V1 | NextSeq 500 | No | Small RNA |
| `v1_multi_lane.csv` | V1 | NovaSeq 6000 | No | 4 lanes, mixed projects |
| `v2_novaseq_x_dual_index.csv` | V2 | NovaSeq X | No | Standard PE150 |
| `v2_with_index_umi.csv` | V2 | NovaSeq X | Index1 UMI (9 bp) | cfDNA / liquid biopsy |
| `v2_with_read_umi.csv` | V2 | NovaSeq X | Read UMI (5 bp) | Duplex sequencing |
| `v2_nextseq_single_index.csv` | V2 | NextSeq 1000/2000 | No | Amplicon panel |

Run the demo to parse all of them:

```bash
python examples/parse_examples.py
```

---

## V1 adapter key reference

From the [Illumina IEM specification](https://knowledge.illumina.com/software/on-premises-software/software-on-premises-software-reference_material-list/000002204), the correct V1 `[Settings]` adapter keys are:

```csv
[Settings]
ReverseComplement,0
Adapter,AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
AdapterRead2,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
```

- `Adapter` = Read 1 adapter (primary key per IEM spec)
- `AdapterRead2` = Read 2 adapter (explicit separate key)
- `AdapterRead1` = BCLConvert V1-mode alias for `Adapter` (also accepted)
- `ReverseComplement,1` = only for Nextera Mate Pair libraries; `0` for everything else

---

## Project structure

```
samplesheet-parser/
├── samplesheet_parser/
│   ├── __init__.py          # Public API
│   ├── factory.py           # SampleSheetFactory — auto-detection
│   ├── enums.py             # SampleSheetVersion, IndexType, ...
│   ├── validators.py        # SampleSheetValidator, ValidationResult
│   └── parsers/
│       ├── v1.py            # IEM V1 parser (bcl2fastq)
│       └── v2.py            # BCLConvert V2 parser (NovaSeq X)
├── tests/
│   ├── conftest.py          # Shared fixtures
│   ├── test_factory.py
│   ├── test_parsers/
│   │   ├── test_v1.py
│   │   └── test_v2.py
│   └── test_validators/
│       └── test_validators.py
├── examples/
│   ├── parse_examples.py    # Demo script
│   └── sample_sheets/       # Reference SampleSheet.csv files
├── pyproject.toml
├── LICENSE
└── README.md
```

---

## Development

```bash
git clone https://github.com/chaitanyakasaraneni/samplesheet-parser
cd samplesheet-parser
pip install -e ".[dev]"

# Run tests
pytest tests/ -v

# Run example demo
python examples/parse_examples.py
```

---

## Citation

If you use this library in a published pipeline or analysis, please cite:

```bibtex
@software{kasaraneni2026samplsheetparser,
  author  = {Kasaraneni, Chaitanya},
  title   = {samplesheet-parser: Format-agnostic parser for Illumina SampleSheet.csv},
  year    = {2026},
  url     = {https://github.com/chaitanyakasaraneni/samplesheet-parser},
  version = {0.1.3}
}
```

---

## License

Apache 2.0 — see [LICENSE](LICENSE).

---

## Related resources

- [Illumina IEM V1 SampleSheet reference (Knowledge Article #2204)](https://knowledge.illumina.com/software/on-premises-software/software-on-premises-software-reference_material-list/000002204)
- [BCLConvert Software Guide](https://support.illumina.com/sequencing/sequencing_software/bcl-convert.html)
- [Upgrading from bcl2fastq to BCLConvert](https://knowledge.illumina.com/software/general/software-general-reference_material-list/000003710)
