Metadata-Version: 2.4
Name: dotmatch
Version: 0.3.1
Summary: Known-target short-DNA assignment from FASTQ for CRISPR guides, barcodes, feature tags, primers, and other targets
Author: Donncha O'Toole
License-Expression: Apache-2.0
Project-URL: Homepage, https://dnncha.github.io/dotmatch/
Project-URL: Repository, https://github.com/dnncha/dotmatch
Project-URL: Issues, https://github.com/dnncha/dotmatch/issues
Project-URL: Documentation, https://dotmatch.readthedocs.io/en/latest/
Project-URL: Agent guide, https://dotmatch.readthedocs.io/en/latest/agent-guide.html
Project-URL: Changelog, https://github.com/dnncha/dotmatch/blob/main/CHANGELOG.md
Project-URL: Examples, https://github.com/dnncha/dotmatch/tree/main/examples
Project-URL: Bioconda, https://anaconda.org/bioconda/dotmatch
Project-URL: Container, https://github.com/dnncha/dotmatch/pkgs/container/dotmatch
Keywords: bioinformatics,computational biology,CRISPR,FASTQ,known-target assignment,feature barcodes,sequencing QC,barcode demultiplexing,guide capture,Perturb-seq,barcode panel design,edit distance
Classifier: Development Status :: 3 - Alpha
Classifier: Environment :: Console
Classifier: Intended Audience :: Science/Research
Classifier: Programming Language :: C
Classifier: Programming Language :: Python :: 3
Classifier: Programming Language :: Python :: 3 :: Only
Classifier: Programming Language :: Python :: 3.9
Classifier: Programming Language :: Python :: 3.10
Classifier: Programming Language :: Python :: 3.11
Classifier: Programming Language :: Python :: 3.12
Classifier: Topic :: Scientific/Engineering :: Bio-Informatics
Requires-Python: >=3.9
Description-Content-Type: text/markdown
License-File: LICENSE
Requires-Dist: tomli; python_version < "3.11"
Provides-Extra: pandas
Requires-Dist: pandas>=1.0; extra == "pandas"
Provides-Extra: anndata
Requires-Dist: anndata>=0.8; extra == "anndata"
Requires-Dist: pandas>=1.0; extra == "anndata"
Provides-Extra: polars
Requires-Dist: polars>=0.19; extra == "polars"
Provides-Extra: multiqc
Requires-Dist: multiqc>=1.20; extra == "multiqc"
Provides-Extra: dev
Requires-Dist: pytest; extra == "dev"
Requires-Dist: pandas>=1.0; extra == "dev"
Requires-Dist: anndata>=0.8; extra == "dev"
Requires-Dist: polars>=0.19; extra == "dev"
Requires-Dist: multiqc>=1.20; extra == "dev"
Dynamic: license-file

# DotMatch

DotMatch is a deterministic CRISPR guide-counting and known-target short-DNA
assignment tool. It assigns short FASTQ read windows to a known list of DNA
sequences and reports every read as a unique match, an ambiguous match,
unmatched, or invalid. It also supports barcodes, feature tags, primers, and
other known targets.

[![CI](https://github.com/dnncha/dotmatch/actions/workflows/ci.yml/badge.svg)](https://github.com/dnncha/dotmatch/actions/workflows/ci.yml)
[![PyPI](https://img.shields.io/pypi/v/dotmatch?label=PyPI)](https://pypi.org/project/dotmatch/)
[![Documentation](https://readthedocs.org/projects/dotmatch/badge/?version=latest)](https://dotmatch.readthedocs.io/en/latest/)
[![Bioconda](https://img.shields.io/conda/vn/bioconda/dotmatch?label=Bioconda)](https://anaconda.org/bioconda/dotmatch)
[![License](https://img.shields.io/badge/license-Apache--2.0-blue.svg)](https://github.com/dnncha/dotmatch/blob/main/LICENSE)
[![DOI](https://zenodo.org/badge/DOI/10.5281/zenodo.20541628.svg)](https://doi.org/10.5281/zenodo.20541628)

[Documentation](https://dotmatch.readthedocs.io/en/latest/) ·
[Getting started](https://dotmatch.readthedocs.io/en/latest/getting-started.html) ·
[Agent guide](https://dotmatch.readthedocs.io/en/latest/agent-guide.html) ·
[Command reference](https://dotmatch.readthedocs.io/en/latest/command-reference.html) ·
[Capability JSON](https://dnncha.github.io/dotmatch/agent-capabilities.json) ·
[Examples](https://github.com/dnncha/dotmatch/tree/main/examples) ·
[Citation](https://dotmatch.readthedocs.io/en/latest/methods-and-citation.html) ·
[Try the notebook in Binder](https://mybinder.org/v2/gh/dnncha/dotmatch/main?labpath=demo.ipynb) ·
[Try the notebook in Google Colab](https://colab.research.google.com/github/dnncha/dotmatch/blob/main/demo.ipynb)

![FASTQ reads and a target table are compared at a fixed read window. DotMatch writes counts, split FASTQs, QC tables, and reports.](https://raw.githubusercontent.com/dnncha/dotmatch/main/public/dotmatch-read-assignment.svg)

## Install

PyPI is the quickest route on Linux and macOS:

```bash
python3 -m pip install dotmatch
dotmatch --version
```

Conda users can install the current Bioconda build:

```bash
conda create -n dotmatch -c conda-forge -c bioconda dotmatch
conda activate dotmatch
```

The Bioconda recipe supports Linux, Intel macOS, and Apple Silicon
(`osx-arm64`). If a newly tagged version has not reached Bioconda yet, use the
PyPI package or install from source.

macOS users who want the native CPU command without Python can use the
[third-party Homebrew tap](https://github.com/dnncha/homebrew-tap):

```bash
brew tap dnncha/tap
brew install dnncha/tap/dotmatch
dotmatch --version
```

This tap is maintained outside Homebrew's official repositories and installs
the native `dotmatch` command from a pinned release source archive. Use PyPI or
Bioconda when you need the Python bindings, AssayCode, or the optional Metal
backend.

For containerised workflows, the current release is also published to GHCR:

```bash
docker pull ghcr.io/dnncha/dotmatch:v0.3.1
docker run --rm ghcr.io/dnncha/dotmatch:v0.3.1 --version
```

The [container package](https://github.com/dnncha/dotmatch/pkgs/container/dotmatch)
is useful when a workflow should pin the release without installing Python or
Conda on the host.

BioContainers also publishes the Bioconda-derived image for workflow runners:

```bash
docker pull quay.io/biocontainers/dotmatch:0.2.2--py311h13f8228_1
docker run --rm quay.io/biocontainers/dotmatch:0.2.2--py311h13f8228_1 dotmatch --version
```

See the [BioContainers package](https://quay.io/repository/biocontainers/dotmatch)
for the other Python-build tags.

Maintainers can refresh the [download metrics
snapshot](https://dotmatch.readthedocs.io/en/latest/download-metrics.html) with
`make download-metrics`. It records provider-reported package retrievals by
channel, version, platform, and Python build; it does not estimate unique users.

## Choose by task

| Intent or search phrase | Entry point | Important limit |
| --- | --- | --- |
| CRISPR guide counting; MAGeCK-compatible counts | `dotmatch crispr-count` | Counting only; no downstream screen statistics |
| Inline barcode demultiplexing; split FASTQ by barcode | `dotmatch demux` | Starts from FASTQ; no basecalling |
| Feature-barcode assignment; TotalSeq feature reads | `dotmatch count` | Per-read assignment; no cell/UMI quantification |
| Perturb-seq guide capture | `dotmatch count` | No guide-per-cell, expression, or perturbation-effect analysis |
| Barcode panel design or collision checking | `dotmatch panel design` or `dotmatch panel check` | Short barcode sets, not probe or full assay design |
| Known-target FASTQ matching; whitelist counting | `dotmatch count` | Finite known targets and one reviewed fixed window |
| High unmatched or ambiguous barcode rate | `dotmatch barcode autopsy` | Diagnostic suggestions require assay-context review |

The [Agent guide](https://dotmatch.readthedocs.io/en/latest/agent-guide.html)
provides copy-paste commands, inputs, outputs, recovery steps, and evidence
limits. Agents and workflow tools can read the same routes from
[`agent-capabilities.json`](https://dnncha.github.io/dotmatch/agent-capabilities.json)
or the installed `dotmatch capabilities --json` command in DotMatch 0.3.0 and
later.

The [Binder](https://mybinder.org/v2/gh/dnncha/dotmatch/main?labpath=demo.ipynb)
and [Colab](https://colab.research.google.com/github/dnncha/dotmatch/blob/main/demo.ipynb)
notebooks run a small synthetic smoke demo without requiring a local install.
They check mechanics only, not biological validation. If you work with a
shareable or de-identified guide, barcode, or other fixed-target fixture, see
the [public validation request](https://github.com/dnncha/dotmatch/issues/82).

## A small example

Prepare a tab-separated target file:

```text
target_id	sequence
guide_001	ACGTACGTACGTACGTACGT
guide_002	ACGTACGTACGTACGTAGGT
```

Then assign a fixed 20-base window from each read:

```bash
dotmatch count \
  --targets guides.tsv \
  --reads sample_R1.fastq.gz \
  --sample-label sample_1 \
  --target-start 23 \
  --target-length 20 \
  --k 1 \
  --metric hamming \
  --out counts.tsv \
  --sample-qc sample_qc.tsv \
  --summary summary.json
```

DotMatch only counts a read when exactly one target is compatible under the
selected matching rule. Reads that fit several targets remain visible as
ambiguous instead of being assigned arbitrarily.

## Try a public CRISPR dataset

After installing the published package, reproduce the checked public
MAGeCK/Yusa guide-counting example from the repository:

```bash
git clone https://github.com/dnncha/dotmatch.git
cd dotmatch
python3 -m pip install dotmatch
DOTMATCH_BIN=dotmatch ./examples/crispr_guides/run.sh
```

This downloads a small public fixture and writes the count matrix, per-read
assignments, and summary under `examples/crispr_guides/output/`. The example
README explains how to fetch the full public data and links to the recorded
[CRISPR comparison
report](https://dotmatch.readthedocs.io/en/latest/benchmarks/public_crispr/README.html).

## Reproduce the public Perturb-seq case study

The [GSE146194 direct-guide-capture case
study](https://github.com/dnncha/dotmatch/blob/main/examples/perturb_seq_gse146194/README.md) uses 32 published guide
barcodes and a bounded, held-out prefix of SRR11214031:

```bash
git clone https://github.com/dnncha/dotmatch.git
cd dotmatch
make bench-perturb-seq-case-study-public
make perturb-seq-case-study-public-gate
```

The workflow verifies the publisher workbook, streams only the first 50,000
FASTQ records, excludes 2,000 discovery reads, and checks 48,000 evaluation
reads against independent exact and exhaustive Hamming oracles. The report
includes unmatched and ambiguous outcomes, hashes, commands, software versions,
and resource measurements. This is per-read fixed-window guide assignment
evidence; it is not guide-per-cell, UMI, expression, perturbation-effect, or
speed-comparison evidence.

For a browser-based smoke demo, launch the [Runnable DotMatch notebook in
Binder](https://mybinder.org/v2/gh/dnncha/dotmatch/main?labpath=demo.ipynb) or
[Google Colab](https://colab.research.google.com/github/dnncha/dotmatch/blob/main/demo.ipynb).
It uses a small synthetic fixture and is intended for workflow orientation, not
biological validation.

## What it is for

- counting CRISPR guides and writing MAGeCK-compatible count tables;
- demultiplexing fixed-position inline barcodes;
- assigning feature-barcode and guide-capture reads;
- checking primer, adapter, amplicon-panel, or whitelist sequences;
- auditing target lists before enabling mismatch correction;
- designing and checking barcode panels;
- writing TSV, JSON, FASTQ, and HTML results for pipelines and lab review.

If you work with guide-capture or perturb-seq data, the public case study above
provides a checked starting point. The [public validation
invitation](https://github.com/dnncha/dotmatch/issues/82) also asks for a short
trial and concrete input/output feedback. Please do not post private reads or
unpublished guide libraries.

If you are choosing a CRISPR guide-counting workflow, see the
[workflow
comparison](https://dotmatch.readthedocs.io/en/latest/usability-comparison.html)
for the documented fit and scope of DotMatch, guide-counter, MAGeCK, and
alignment-based alternatives.

DotMatch is not a genome aligner, basecaller, UMI pipeline, variant caller, or
screen-level statistics package. It compares short read windows with a finite
target list.

## Read outcomes

| Outcome | Meaning |
| --- | --- |
| `unique` | Exactly one target is compatible. |
| `ambiguous` | More than one target is compatible. |
| `none` | No target is within the selected distance. |
| `invalid` | The requested read window could not be extracted. |

These states appear in the assignment and QC outputs. They are not folded into
the unique counts.

## Common workflows

### Count CRISPR guides

For a new screen, DotMatch can prepare a small assay project and infer a likely
guide window for review:

```bash
dotmatch crispr quickstart \
  --library guides.csv \
  --fastq 'fastqs/*.fastq.gz' \
  --out crispr_screen/
```

Review `crispr_screen/inference_report.json` and `assay.toml`, then run:

```bash
dotmatch assay start crispr_screen/assay.toml
```

After a completed run, create a compact technical review bundle without copying
raw FASTQs:

```bash
dotmatch assay handoff crispr_screen/assay.toml
```

The bundle includes configuration, QC, reports, methods, citation material, and
checksums for declared inputs and copied outputs. See the [lab evaluation and
handoff guide](https://dotmatch.readthedocs.io/en/latest/lab-evaluation.html)
for the review sequence and data-handling boundary.

For an explicit one-command run, use `dotmatch crispr-count`. The
[CRISPR tutorial](https://dotmatch.readthedocs.io/en/latest/tutorials/crispr-count-first-run.html)
covers both routes.

### Demultiplex inline barcodes

```bash
dotmatch demux \
  --barcodes barcodes.tsv \
  --reads pooled.fastq.gz \
  --barcode-start 0 \
  --barcode-length 8 \
  --k 1 \
  --metric hamming \
  --out-dir demuxed/ \
  --summary demux.summary.json
```

If a run has an unexpectedly high unmatched or ambiguous rate, inspect it with:

```bash
dotmatch barcode autopsy \
  --barcodes barcodes.tsv \
  --reads pooled.fastq.gz \
  --scan-starts 0:12 \
  --k-values 0,1 \
  --out-dir autopsy/
```

Open `autopsy/report.html` first. The tables beside it record offset scans,
near-neighbour barcodes, correction safety, and frequent unmatched windows.

### Build a cell-by-feature matrix from extracted observations

When an upstream workflow has already extracted feature windows and attached an
explicit cell identifier, DotMatch can write a sparse cells × features matrix:

```bash
dotmatch feature matrix \
  --observations feature_observations.tsv \
  --targets feature_library.tsv \
  --id-column observation_id \
  --cell-column cell_barcode \
  --sequence-column feature_seq \
  --metric hamming --k 1 \
  --out-dir feature_matrix/
```

The output directory contains `matrix.mtx`, cell and feature axes, long-form
counts, per-observation assignments, per-cell QC, and a JSON summary. Only
unique assignments add a matrix count. This command does not perform FASTQ
pairing, cell-barcode correction, UMI deduplication, or cell calling; those
upstream steps should remain documented with the observation table.

See the [scverse and feature-barcode tutorial](https://dotmatch.readthedocs.io/en/latest/tutorials/scverse-perturb-seq.html)
for the file contract and AnnData handoff.

### Count target pairs across R1 and R2

Use `pair-count` when a left target and a right target are sequenced in
synchronized FASTQ mates:

```bash
dotmatch pair-count \
  --left-targets r1_targets.tsv \
  --right-targets r2_targets.tsv \
  --left-reads sample_R1.fastq.gz \
  --right-reads sample_R2.fastq.gz \
  --left-start 0 --left-length 20 \
  --right-start 0 --right-length 20 \
  --k 1 --metric hamming \
  --out pair_counts.tsv \
  --summary pair_summary.json
```

R1 and R2 must contain the same records in the same order. DotMatch checks the
canonical read identifier before assignment and records input synchronization,
side-specific unmatched totals, and side-specific invalid totals in the summary.

### Check a target library

Before allowing mismatch correction, check whether neighbouring targets can
produce ambiguous assignments:

```bash
dotmatch audit \
  --targets guides.tsv \
  --k 1 \
  --audit-mode auto \
  --out-dir audit/
```

The [barcode panel guide](https://dotmatch.readthedocs.io/en/latest/barcode-panel-design.html)
also covers panel design, optimisation, simulation, layout, and export.

## Python API

```python
import dotmatch

distance = dotmatch.distance("ACGT", "AGGT")
assert distance == 1

result = dotmatch.assign_posterior("ACGT", ["ACGT", "AGGT"], "IIII")
print(result.status)
```

The posterior helper is experimental and is not used by the high-throughput
CLI path. The [Python API documentation](https://dotmatch.readthedocs.io/en/latest/streaming-api.html)
describes the supported streaming interfaces.

## Outputs and workflow integration

Depending on the command, DotMatch writes count tables, split FASTQs,
`sample_qc.tsv`, per-read assignments, unmatched-read tables, `summary.json`,
and self-contained HTML reports. The formats are documented in the
[output schema reference](https://dotmatch.readthedocs.io/en/latest/schemas.html).

Examples for Nextflow, nf-core, Snakemake, Galaxy, and MultiQC live under
[`examples/workflows`](https://github.com/dnncha/dotmatch/tree/main/examples/workflows).
The [ecosystem status ledger](https://dotmatch.readthedocs.io/en/latest/ecosystem-status.html)
separates local examples, open upstream submissions, accepted contributions,
released integrations, and installable package-manager channels.
The desktop Workbench is maintained separately in
[`dotmatch-community`](https://github.com/dnncha/dotmatch-community).

## Matching rules and performance

Hamming distance is the usual choice for fixed-length windows where only base
substitutions should be considered. Levenshtein distance can also account for
short insertions and deletions. The default radius policy requires a single
compatible target; the optional `best` policy exists for compatibility with
workflows that select the nearest target.

Indexed candidate generation and native distance kernels make fixed-window
assignment practical for large FASTQ inputs. Benchmark results, hardware,
commands, and known limitations are kept with the
[benchmark reports](https://dotmatch.readthedocs.io/en/latest/benchmarks/README.html).
Those reports cover the tested workloads; they are not a claim that DotMatch
replaces general alignment or every demultiplexing workflow.

## Documentation

- [Agent guide](https://dotmatch.readthedocs.io/en/latest/agent-guide.html)
- [Getting started](https://dotmatch.readthedocs.io/en/latest/getting-started.html)
- [Command reference](https://dotmatch.readthedocs.io/en/latest/command-reference.html)
- [AssaySpec workflows](https://dotmatch.readthedocs.io/en/latest/assayspec.html)
- [Lab evaluation and handoff](https://dotmatch.readthedocs.io/en/latest/lab-evaluation.html)
- [CRISPR count QC](https://dotmatch.readthedocs.io/en/latest/crispr-qc.html)
- [Barcode panel design](https://dotmatch.readthedocs.io/en/latest/barcode-panel-design.html)
- [Output schemas](https://dotmatch.readthedocs.io/en/latest/schemas.html)
- [Methods and citation](https://dotmatch.readthedocs.io/en/latest/methods-and-citation.html)
- [Packaging notes](https://dotmatch.readthedocs.io/en/latest/packaging.html)

## Citation

Run `dotmatch citation` to print the citation for the installed version. The
repository also includes [`CITATION.cff`](https://github.com/dnncha/dotmatch/blob/main/CITATION.cff),
and release archives are deposited with Zenodo.

## Development

```bash
git clone https://github.com/dnncha/dotmatch.git
cd dotmatch
make
make test
```

See [CONTRIBUTING.md](https://github.com/dnncha/dotmatch/blob/main/CONTRIBUTING.md)
for the development setup and pull-request checks.

## License

Apache-2.0. See [LICENSE](https://github.com/dnncha/dotmatch/blob/main/LICENSE).
