Metadata-Version: 2.4
Name: pydustmasker
Version: 3.1.0
License-File: LICENSE
Summary: Python bindings algorithms for identifying and masking low-complexity regions in nucleotide and protein sequences
Author-email: Antonio Camargo <antoniop.camargo@gmail.com>
License-Expression: MIT
Requires-Python: >=3.10
Description-Content-Type: text/markdown; charset=UTF-8; variant=GFM
Project-URL: documentation, https://apcamargo.github.io/pydustmasker
Project-URL: homepage, https://apcamargo.github.io/pydustmasker
Project-URL: repository, https://github.com/apcamargo/pydustmasker

# pydustmasker

`pydustmasker` provides a unified Python interface to the SDUST[^1], Longdust[^2], and tantan[^3] algorithms for detecting and masking low-complexity regions and tandem repeats in nucleotide and protein sequences.

## Documentation

The full documentation for `pydustmasker`, including installation instructions, theoretical background, and API reference, is available at <https://apcamargo.github.io/pydustmasker>.

## Installation

Using `pip`:

```sh
pip install pydustmasker
```

Using [`pixi`](https://pixi.sh/):

```sh
# Create a new Pixi workspace and navigate into the workspace directory
pixi init my_workspace && cd my_workspace
# Add Bioconda to the list of channels of your Pixi workspace
pixi workspace channel add bioconda
# Add pydustmasker to your Pixi workspace
pixi add pydustmasker
```

## Usage

To identify and mask low-complexity regions in a nucleotide sequence, create an instance of a masker class and provide your sequence to it. A masker class implements a specific low-complexity detection algorithm and provides methods to retrieve the detected regions and to generate a masked version of the sequence. `pydustmasker` provides three such classes, corresponding to different detection algorithms: [SDUST](https://apcamargo.github.io/pydustmasker/theory#sdust), [Longdust](https://apcamargo.github.io/pydustmasker/theory#longdust), and [tantan](https://apcamargo.github.io/pydustmasker/theory#tantan). These algorithms are implemented in three different classes:
- [`DustMasker`](https://apcamargo.github.io/pydustmasker/api#pydustmasker.DustMasker)
- [`LongdustMasker`](https://apcamargo.github.io/pydustmasker/api#pydustmasker.LongdustMasker)
- [`TantanMasker`](https://apcamargo.github.io/pydustmasker/api#pydustmasker.TantanMasker)

```py
>>> import pydustmasker
# Example nucleotide sequence
>>> seq = "CGTATATATATAGTATGCGTACTGGGGGGGCT"
# Create a DustMasker object to identify low-complexity regions with the SDUST algorithm
>>> masker = pydustmasker.DustMasker(seq)
# The len() function returns the number of low-complexity regions detected in the sequence
>>> len(masker)
1
# Get the number of bases within low-complexity regions and the intervals of these regions
>>> masker.n_masked_bases
7
>>> masker.intervals
((23, 30),)
# The masker object is iterable, yielding start and end positions of each low-complexity region
>>> for start, end in masker:
...     print(f"{start}-{end}: {seq[start:end]}")
23-30: GGGGGGG
```

### Masking low-complexity regions

You can generate a masked version of the sequence using the `mask()` method. By default, low-complexity regions are soft-masked by converting bases to lowercase. Setting the `hard` parameter to `True` enables hard-masking, in which affected bases are replaced with the ambiguous nucleotide `N`.

```py
# The mask() method returns the sequence with low-complexity regions soft-masked
>>> masker.mask()
'CGTATATATATAGTATGCGTACTgggggggCT'
# Hard-masking can be enabled by setting the `hard` parameter to `True`
>>> masker.mask(hard=True)
'CGTATATATATAGTATGCGTACTNNNNNNNCT'
```

### Tuning the detection of low-complexity regions

The identification of low-complexity regions can be tuned via algorithm-specific parameters. All of the provided masker classes provide multiple parameters, documented in the [API reference](https://apcamargo.github.io/pydustmasker/api), that enable control how low-complexity regions are determined. One shared parameter is `score_threshold`, which controls detection stringency: lowering this threshold results in more regions being classified as low-complexity, whereas increasing it restricts detection to the most clearly low-complexity regions.

```py
# Setting `score_threshold` to 10 results in more low-complexity regions being detected
>>> masker = pydustmasker.DustMasker(seq, score_threshold=10)
>>> len(masker)
2
>>> masker.intervals
((2, 12), (23, 30))
>>> masker.mask()
'CGtatatatataGTATGCGTACTgggggggCT'
```

### Identifying tandem repeats in protein sequences

Although the SDUST and Longdust are specifically designed for nucleotide sequences, the tantan algorithm can also be used to identify tandem repeats in proteins. The `TantanMasker` class provides a `protein` parameter that enables this functionality.

```py
# Example protein sequence with an imperfect tandem repeat
>>> protein = "QAEMSTNPKPMSTNPKPMSTDPKPMSTNPKPMSTNPKPMSTNDEH"
# Set protein=True to identify tandem repeats in a protein sequence
>>> masker = pydustmasker.TantanMasker(protein, protein=True)
# Get the intervals of the tandem repeats identified in the sequence
>>> masker.intervals
((9, 38),)
# Generate a soft-masked sequence
>>> masker.mask(hard=True)
'QAEMSTNPKXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXEH'
```

In addition to masking, `TantanMasker` can determine tandem repeat units through the `repeat_units()` method.

```py
# Each repeat unit is represented by a (unit, start, end, copy_number) tuple
>>> masker.repeat_units()
(('MSTNPKP', 3, 42, 5.571428571428571),)
```

## Processing sequences in parallel

When working with large numbers of sequences, you can run `pydustmasker` in parallel to process multiple sequences at the same time. This can substantially reduce the total time needed to process all sequences.

The example below uses [Biopython](https://biopython.org/) to parse a FASTA file containing multiple sequences, which are then processed in parallel using a pool of worker processes from the [`multiprocessing`](https://docs.python.org/3/library/multiprocessing.html) module. Each sequence record is submitted to the worker pool via `imap` and processed with `LongdustMasker` to identify low-complexity regions using the Longdust algorithm. The resulting intervals are written to the output file as they become available.

```py
#!/usr/bin/env python

import multiprocessing.pool

from Bio import SeqIO
from Bio.SeqRecord import SeqRecord

import pydustmasker

INPUT_FILE = "sequences.fna"
OUTPUT_FILE = "lc_intervals.tsv"

Intervals = tuple[tuple[int, int], ...]

# The `process_record()` function encapsulates the computation performed on a
# single sequence record. A wrapper like this is necessary because process pools
# distribute work by invoking a single function for each item
def process_record(record: SeqRecord) -> tuple[str, Intervals]:
    masker = pydustmasker.LongdustMasker(str(record.seq))
    return record.id, masker.intervals


if __name__ == "__main__":
    # A process pool is created using `multiprocessing.pool.Pool()`, which
    # automatically manages a set of worker processes. If you are using a
    # free-threaded version of Python, you can also use
    # `multiprocessing.pool.ThreadPool()` to create a pool of threads instead
    # of processes
    with open(OUTPUT_FILE, "w") as f, multiprocessing.pool.Pool() as pool:
        records = SeqIO.parse(INPUT_FILE, "fasta")
        # `SeqIO.parse()` is used to lazily read sequence records from the input
        # FASTA file, avoiding the need to load all sequences into memory at
        # once. Each record is submitted to the process pool via `pool.imap()`,
        # which returns an iterator that yields results in the order they were
        # submitted
        for name, intervals in pool.imap(process_record, records):
            for start, end in intervals:
                f.write(f"{name}\t{start}\t{end}\n")
```

## References

[^1]: Morgulis, Aleksandr, *et al*. **A Fast and Symmetric Dust Implementation to Mask Low-Complexity DNA Sequences**. *Journal of Computational Biology*, vol. 13, no. 5, June 2006, pp. 1028–40. <https://doi.org/10.1089/cmb.2006.13.1028>.

[^2]: Li, Heng, and Brian Li. **Finding Low-Complexity DNA Sequences with Longdust**. *Bioinformatics*, vol. 42, no. 3, Feb. 2026, p. btag112. <https://doi.org/10.1093/bioinformatics/btag112>.

[^3]: Frith, Martin C. **A New Repeat-Masking Method Enables Specific Detection of Homologous Sequences**. *Nucleic Acids Research*, vol. 39, no. 4, Mar. 2011, pp. e23–e23. <https://doi.org/10.1093/nar/gkq1212>.

